Log In Sign up
The largest database of trusted experimental protocols

Ssiii cdna

Manufactured by Thermo Fisher Scientific
Visit Supplier

The SSIII cDNA is a reverse transcriptase enzyme used for the synthesis of first-strand cDNA from RNA templates. It is a highly processive and sensitive enzyme that can generate full-length cDNA from a wide range of RNA input amounts.

Automatically generated - may contain errors

Lab products found in correlation

Primestar gxl polymerase, by Takara Bio (2 mentions) Nebuilder hifi dna assembly master mix, by New England Biolabs (2 mentions)

2 protocols using ssiii cdna

1

Heat-Inducible Misexpression of Zebrafish Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length coding sequences were amplified from SSIII cDNA (Thermo Fisher) using Primestar-GXL polymerase (Takara) and the following primers: fgf20a 5′-AAGCAGGCTCACCATGGGTGCAGTCGGCGA; 5′- GACTGCACCCATGGTGAGCCTGCTTTTTTGTACAAACTTGG; pdgfaa 5′- GCAGATATAAGGTGCGCCAGCGTCACCCA, 5′-CGCGGTTCTCATGGTGAGCCTGCTTTTTTGTACAAACTTGG. Coding sequences were cloned into a hsp70l heatshock misexpression vector from Aman et al., 2018 (link) using NEBuilder HiFi DNA Assembly Master Mix (NEB). Zygotes were injected and raised to 8.5 SSL and given 6 × 1 hr 41°C heatshocks per day for 7 d in a modified Aquaneering rack. Only individuals with epidermal basal cell expression were selected for analysis.
Aman A.J., Saunders L.M., Carr A.A., Srivatasan S., Eberhard C., Carrington B., Watkins-Chow D., Pavan W.J., Trapnell C, & Parichy D.M. (2023). Transcriptomic profiling of tissue environments critical for post-embryonic patterning and morphogenesis of zebrafish skin. eLife, 12, RP86670.
+ Open protocol
+ Expand
2

Heat-Inducible Misexpression of Zebrafish Genes

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length coding sequences were amplified from SSIII cDNA (Thermo Fisher) using Primestar-GXL polymerase (Takara) and the following primers: fgf20a 5′-AAGCAGGCTCACCATGGGTGCAGTCGGCGA; 5′- GACTGCACCCATGGTGAGCCTGCTTTTTTGTACAAACTTGG; pdgfaa 5′- GCAGATATAAGGTGCGCCAGCGTCACCCA, 5′-CGCGGTTCTCATGGTGAGCCTGCTTTTTTGTACAAACTTGG. Coding sequences were cloned into a hsp70l heatshock misexpression vector from Aman et al., 2018 (link) using NEBuilder HiFi DNA Assembly Master Mix (NEB). Zygotes were injected and raised to 8.5 SSL and given 6 × 1 hr 41°C heatshocks per day for 7 d in a modified Aquaneering rack. Only individuals with epidermal basal cell expression were selected for analysis.
Aman A.J., Saunders L.M., Carr A.A., Srivatasan S., Eberhard C., Carrington B., Watkins-Chow D., Pavan W.J., Trapnell C, & Parichy D.M. (2023). Transcriptomic profiling of tissue environments critical for post-embryonic patterning and morphogenesis of zebrafish skin. eLife, 12, RP86670.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!