Total RNA was extracted from MIN6 cells and isolated mouse pancreatic islets using peqGold Trifast (Peqlab). In all, 0.2 μg (islets) or 0.4 μg (MIN6 cells) of purified RNA was reverse transcribed into complementary DNA using Superscript II reverse transcriptase (Invitrogen) with random primers according to the protocol provided by the manufacturer. Real-time RT–PCR was performed using an Mx3000P and the 2 × Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies). Each sample was run in triplicate and analysed according to the threshold cycle (Ct) method. For normalization, primer sequences complementary to complementary DNA sequences of α-tubulin or Hypoxanthine-guanine-phosphoribosyltransferase (Hprt) were used. Primer sequences are summarized Supplementary Table 2 .
Brilliant 3 sybr green qpcr master mix
Manufactured by Agilent Technologies
Sourced in United States, United Kingdom
Brilliant III SYBR Green QPCR Master Mix is a pre-formulated solution designed for quantitative real-time PCR (qPCR) analysis. It contains all the necessary components, including SYBR Green I dye, for the amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Mx3000p, by Agilent Technologies (8 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (8 mentions)
Rneasy kit, by Qiagen (6 mentions)
Rneasy plant mini kit, by Qiagen (5 mentions)
Rneasy mini kit, by Qiagen (5 mentions)
M mlv reverse transcriptase, by Promega (4 mentions)
Mx3000p qpcr system, by Agilent Technologies (3 mentions)
Turbo dna free, by Thermo Fisher Scientific (3 mentions)
Tri reagent, by Molecular Research Center (3 mentions)
Revertra ace, by Toyobo (3 mentions)
Steponeplus, by Thermo Fisher Scientific (3 mentions)
Rnalater, by Thermo Fisher Scientific (3 mentions)
Rneasy plus mini kit, by Qiagen (2 mentions)
First strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Random dt primers, by Promega (2 mentions)
Revertaid h minus reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Superscript 2, by Thermo Fisher Scientific (2 mentions)
Rnaeasy mini kit, by Qiagen (2 mentions)
Mx3005p instrument, by Agilent Technologies (2 mentions)
55 protocols using brilliant 3 sybr green qpcr master mix
1
RNA Extraction and RT-qPCR Analysis of MIN6 Cells and Mouse Islets
2
Quantifying Gene Expression via RT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the Qiagen Allprep DNA/RNA mini kit (cat.#80204). A total of three micrograms of total RNA were reverse-transcribed using SuperScript II Reverse Transcriptase (Life Technologies) to synthesize cDNA. Quantitative RT-PCR was performed on a Stratagene Mx3000P using 2× Brilliant III SYBR Green qPCR Master Mix plus ROX reference dye (Agilent Technologies). The thermal profiles were set according to the manufacturer’s protocol. The mRNA levels were normalized to Hprt1: (Forward primer: CCTAAGATGAGCGCAAGTTGAA, reverse: CCACAGGACTAGAACACCTGCTAA), PI3Kca: (Forward primer: CCACGACCATCTTCGGGTG, reverse: ACGGAGGCATTCTAAAGTCACTA) H19: (Forward primer: GGAATGTTGAAGGACTGAGGG, reverse: GTAACCGGGATGAATGTCTGG), Igf2: (Forward primer: TCAGTTTGTCTGTTCGGACC, reverse: CACTCTTCCACGATGCCAC).
3
Drought Stress Response Genes in Amorpha fruticosa
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Differentially expressed genes play a crucial role in drought stress resistance in Amorpha fruticosa L. The genes that are more affected by drought stress are those related to the scavenging homeostatic system of reactive oxygen species in plants; genes related to the signal transduction transcriptional regulation and metabolic regulation pathways are differentially expressed in response to drought stress. Therefore, in this study, 20 genes from the above three categories were selected for qRT-PCR validation. qRT-PCR analysis was performed on an Agilent Mx3000P QPCR system (Agilent, USA) using 2 × Brilliant III SYBR Green qPCR Master Mix (Agilent, USA). PCR amplification was performed under the following conditions: 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 58 °C for 30s, and 72 °C for 30 s and a final extension at 72 °C for 5 min. Quantification of gene expression was performed by the comparative 2−ΔΔCT method (Guan et al., 2014 (link)). The validation analysis was performed with three independent biological replicates. The gene-specific primers for qRT-PCR were designed using Primer Premier 5.0 (http://www.PremierBiosoft.com ) and were synthesized by Invitrogen (Carlsbad, USA). The gene β-actin was used as the housekeeping gene. Data was analyzed by one-way ANOVA with Tukeys post hoc test.
4
Quantification of Mi-col-1 and Lemmi-5 Expression in M. incognita Life Stages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of Mi-col-1 and Lemmi-5 was quantified at different life stages of M. incognita through quantitative real time PCR (qRT-PCR) using cDNAs from J2s, egg masses and adult females. Total RNA was isolated and from these developmental stages, quantified and first stranded cDNA was synthesized as described above. A constitutively expressed gene, 18s rRNA was used as an internal control to normalize the gene expression levels. qRT-PCR was performed in a CFX96 real time system (Biorad) using 2X brilliant III SYBR Green q-PCR master mix (Agilent). 20 μL reaction mixture for each sample consisted of 10 μL of 2X SYBR green qPCR master mix, 500 nM of each gene specific primer (Table 1 ) and 100 ng of first strand cDNA. Two biological and three technical replicates were taken for each sample. The amplification reactions included initial denaturation of 95°C for 5 min, followed by 35 cycles of 95°C for 30 s and 60°C for 1 min. A melt curve analysis at 60–95°C was performed after 35 cycles for assessment of the amplification specificity. Fold change in gene expression was quantified by 2−ΔΔCT method using mean Ct values for each amplification (Livak and Schmittgen, 2001 (link)).
5
Quantifying Gene Expression from Brain Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from brain samples using TRIzol (Invitrogen, USA). RNA was treated with TURBO DNA-free™ (Ambion Texas USA) and subsequently verified for optical density 260/280 absorption ratios. RNA integrity was evaluated by denaturing gel electrophoresis. CDNA was synthesized with an ImProm II reverse transcription system (Promega, Madison, USA), using oligo dT primers. RT-qPCR was performed using 2X Brilliant III SYBR® Green QPCR Master Mix (Agilent Technologies, USA) in a MX3000 system (Stratagene, La Jolla, CA, USA). Primer sequences were designed with Primer3 software as follows:
| Primers | Forward sequence | Reverse sequence |
|---|---|---|
| p65 | 5′-ATAACTCGC CTGGTGACAGGAT-3′ | 5′-CTGAGAAGTCCATGTCCGCAAT-3′ |
| IL-1β | 5′-CTGCAGGCTTCGAGATGAACAA-3′ | 5′-TGTCCATTGAGGTGGAGAGCTT-3′ |
| TNF-α | 5′-GGCCAATGGCATGGATCTCAAA-3′ | 5′-AGC CTT GTC CCT TGA AGA GAA C-3′ |
| GAPDH | 5′-CCTGCC AAGTATGATGACATCAA-3′ | 5′-AGC CCA GGA TGC CCT TTA GT-3′ |
6
Quantitative Analysis of Neuroinflammatory Markers in Neonatal Brains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Homogenization of tissue, extraction, and quantification of RNA for RT-qPCR: Telencephalon samples at P1, 7, and 14 of CS and AS neonates under basal conditions were homogenized with a Cordless Pellet Pestle homogenizer (Kimble Chase, DWK, Life Sciences, Rockwood, TN, USA). Total RNA was purified using TRIzol reagent (Invitrogen, Thermo-Fisher). The concentration and purity of total RNA was determined for optical density 260/280 absorption ratios. RNA integrity was evaluated by denaturing gel electrophoresis. One microgram of total RNA was used to perform reverse transcription with MMLV reverse transcriptase (Invitrogen) and oligo dT primers. RT-qPCR reactions were performed to amplify: (i) Olig-1 and Olig-2; (ii) MBP, and (iii) the inflammatory cytokines IL-1β, IL-6, TNF-α and COX-2, using a Light-Cycler 1.5 thermocycler (Roche, Indianapolis, IN, USA). RT-qPCR was performed using 2X Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA) in a MX3000 system (Stratagene, La Jolla, CA, USA). Primer sequences used for amplification are indicated in Supplementary Table S1 . β-Actin was chosen as the housekeeping gene, based on the similarity of mRNA expression across all sample templates. Relative quantification was performed by the ΔΔCT method.
7
Quantifying Target Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Each RT-qPCR reaction was performed in triplicate in a final volume of 25 μl, containing 12.5 μl of 2X Brilliant III SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, USA), 1.25 μl of each appropriate primer, 2 μl of cDNA and 8 μl of nuclease free water. The RT-qPCR reactions were performed in the “CFX Connect Real-Time PCR Detection System” thermocycler (BIO-RAD, Hercules, USA) under conditions including an initial step at 95 °C for 10 min followed by 45 cycles of 95 °C for 15 s, 58 °C for 1 min, and 72 °C for 30 s. An additional step starting between 90 °C and 58 °C was performed to establish a melting curve and check the specificity of each primer pair [20 (link)]. Threshold cycle (Ct) values for each sample were obtained using Bio-Rad's CFX Manager software. The Ct value is the basis for the calculation of the relative quantification, corresponding to the expression of the target gene compared to the house-keeping gene. The analysis of the relative expression of the target genes was determined using the 2−(ΔΔCt) method [21 (link)]. To know the reproducibility of the data, the efficiency was determined according to the following equation E = [10-1/s −1]*100, with s corresponding to the standard curve obtained from several dilutions of the cDNA [22 (link)].
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction was performed as previously described (Tréguer et al., 2013) . cDNA was synthesized from 1µg of RNA in 20µL final volume with Promega reverse transcriptase. Semi quantitative PCR was performed with the PCR primers listed in Table S1 and analysed on agarose gel as previously described (Tocco et al., 2015) . Real time PCR was performed in a final volume of 20µL with the Mx3000P QPCR system (Stratagene-Agilent). The reaction mixture consisted of 10µL of 2x Brilliant III SYBR green QPCR master mix (Agilent), 5µM of each primer (Table S1) and 2µL of 1/100 dilution of cDNA. The cycling conditions were as follows: denaturation at 95°C (15 s), annealing at 60°C (30 s) and extension at 64°C (22 sec). A single specific product was amplified and confirmed by melting curve analysis. Each reaction includes a control without template and a standard curve of serial dilution points (10fold step). Odc was used as an internal reference and the relative expression of each gene was calculated using the ∆∆ct method. Expression was calculated relative to uninjected controls.
Each data point represents the mean +SEM of at least three independent experiments.
Each data point represents the mean +SEM of at least three independent experiments.
9
Transcriptional Profiling of Moniliophthora roreri
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reads from 30 DPI and 60 DPI libraries were mapped to the nucleotide sequences of predicted protein coding genes of the M. roreri genome using the short read aligner Bowtie-0.12.7 which utilizes a Burrows-Wheeler index [85 (link)]. Count data were obtained for each coding sequence. Estimation and statistical analysis of expression levels using count data of each gene with 3 replicates for each library was performed using the DEseq package [86 (link)] and R x64 2.15.2 program. (http://www.r-project.org/ ).
After RNA-Seq, twenty five genes were chosen for analysis by RT-qPCR across the full set of infected pods. For RT-qPCR analysis, seven replicate malformed green pods 30 DPI and seven replicate necrotic sporulating pods (60 DPI) were used. RT-qPCR analysis was conducted following Bailey et al. [21 ], using Brilliant III® SYBR® Green Q-PCR Master Mix (Agilent, Santa Clara, CA). Primer sources, sequences for the M. roreri genes are in Additional file3 . M. roreri ESTs were chosen based upon results of RNA-Seq analysis. RT-qPCR was conducted to determine the changes in expression of M. roreri genes between the biotrophic and necrotrophic phases of FPR. The ddCt method was used to calculate the fold-change between the 30 and 60 day DPI samples [87 (link),88 (link)].
After RNA-Seq, twenty five genes were chosen for analysis by RT-qPCR across the full set of infected pods. For RT-qPCR analysis, seven replicate malformed green pods 30 DPI and seven replicate necrotic sporulating pods (60 DPI) were used. RT-qPCR analysis was conducted following Bailey et al. [21 ], using Brilliant III® SYBR® Green Q-PCR Master Mix (Agilent, Santa Clara, CA). Primer sources, sequences for the M. roreri genes are in Additional file
10
Comprehensive Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction, cDNA synthesis, and qPCR (RT‐qPCR) were performed essentially as described previously (James et al., 2008 ; James, Syed, Bordage, et al., 2012 ). Total RNA was extracted with the RNeasy Plant Mini kit (Qiagen) and DNase treated (DNA‐free; Ambion). Complementary DNA (cDNA) was typically synthesized from 2 μg of total RNA using oligo dT primers and SuperScriptII reverse transcriptase (ThermoFisher Scientific). qPCR reactions (1:100 dilutions of cDNA) were performed with Brilliant III SYBR Green QPCR Master Mix (Agilent) on a StepOnePlus (Fisher Scientific‐UK Ltd, Loughborough, UK) real‐time PCR system. The average Ct values for PP2A (At1g13320) and IPP2 (At3g02780) were used as internal control expression levels. The delta‐delta‐Ct algorithm (Livak & Schmittgen, 2001 ) was used to determine relative changes in gene expression. RT‐PCR was performed using cDNAs and GoTaq Green DNA polymerase (Promega). Products were co‐electrophoresed on 1.5% agarose, 0.5 × TBE gels with 100 bp markers (Roche Diagnostics) and stained with SYBR safe DNA gel stain (ThermoFisher Scientific). All primer sequences are provided in Table S1 . Schematics of regions amplified are detailed in Note S2 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!