Nucleospin rna protein kit

Manufactured by Macherey-Nagel

Sourced in Germany, France, United States

The NucleoSpin RNA/Protein kit is a laboratory tool designed to isolate and purify both RNA and protein from the same sample. It utilizes a silica-membrane technology to efficiently capture and separate RNA and protein, providing a reliable and convenient method for simultaneous extraction of these biomolecules.

Automatically generated - may contain errors

Lab products found in correlation

122 protocols using nucleospin rna protein kit

Protein Isolation and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins were isolated from cells and kidney tissue using NucleoSpin RNA/Protein kits (Macherey-Nagel). Protein concentration was calculated using the Bradford assay with bicinchoninic acid (B9643, Sigma) and copper sulfate (C2284, Sigma) solutions. Proteins were separated by 8–15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes (AE-6667-P, ATTO). The following primary antibodies were used in this study: Atg5 (#12294, Cell Signaling Technology), LC3 A/B (#12741, Cell Signaling Technology), p62 (#5114 and #23214, Cell Signaling Technology), Pten (#9552, Cell Signaling Technology), pDVL (ab124933, Abcam), Dvl2 (#3224, Cell Signaling Technology), and β-actin (A300-491A, Bethyl Laboratories).
Membranes were blocked with 5% skimmed milk in PBST (1 × PBS with 1% Tween-20), incubated with primary antibodies diluted in 1% skimmed milk with PBST overnight at 4°C, washed with PBST, and incubated with secondary antibodies in 2% skimmed milk for 1 h at room temperature. Protein bands were detected using enhanced chemiluminescent reagents (WSE-7120 EzWestLumi plus, ATTO) and band intensity was visualized using an LAS-3000 instrument (Fujifilm).

Mun H., Lee E.J., Park M., Oh G.T, & Park J.H. (2020). The Autophagy Regulator p62 Controls PTEN-Dependent Ciliogenesis. Frontiers in Cell and Developmental Biology, 8, 465.

+ Open protocol

+ Expand

qRT-PCR RNA Isolation and Analysis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA isolation was performed with NucleoSpin RNA/Protein kits from Macherey-Nagel according to the manufactures instructions including on column DNase treatment. The RNA concentration and quality was measured with spectroscopy (Nanodrop, Thermo Fisher Scientific) and capillary electrophoresis (Agilent 2100 Bioanalyzer). Approximately 1 µg total RNA was reverse transcribed using the Multi-Scribe RT kit (Applied Biosystems, Carlsbad, CA) with random hexamers. Reactions were performed in triplicate using SYBR Green I master mix (Applied Biosystems, Carlsbad, CA). Normalization and error propagation were calculated as described [116] (link). Relative quantities were normalized to beta-actin. Sequences of qPCR primer pairs are provided in S8 Table.

Isensee J., Wenzel C., Buschow R., Weissmann R., Kuss A.W, & Hucho T. (2014). Subgroup-Elimination Transcriptomics Identifies Signaling Proteins that Define Subclasses of TRPV1-Positive Neurons and a Novel Paracrine Circuit. PLoS ONE, 9(12), e115731.

+ Open protocol

+ Expand

Protein Extraction from Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteins from PBMCs were isolated with the NucleoSpin RNA/Protein Kit (Macherey-Nagel). Nuclear and cytoplasmic proteins from transfected HEK293T cells were obtained with the NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific). Concentrations were measured with Protein Quantification Kit (Macherey-Nagel).

Schröder C., Sogkas G., Fliegauf M., Dörk T., Liu D., Hanitsch L.G., Steiner S., Scheibenbogen C., Jacobs R., Grimbacher B., Schmidt R.E, & Atschekzei F. (2019). Late-Onset Antibody Deficiency Due to Monoallelic Alterations in NFKB1. Frontiers in Immunology, 10, 2618.

+ Open protocol

+ Expand

RNA Isolation and RT-PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the Nucleospin^® RNA/Protein kit (740933, Macherey-Nagel GmbH & Co., Dueren, Germany) following the manufacturer’s protocol. Concentration of isolated RNA was determined using NanoDrop One (Thermo Fisher scientific), and 1 μg of RNA was used for RT-PCR. A mixture of RNA, oligo dT (Bioneer), dNTPs (Promega, WI, USA), RNase inhibitor (N211A, Promega), and M-MLV reverse transcriptase (M170B, Promega) was incubated at 42°C for 1 h. Then, cDNA synthesis was stopped at 70°C.

Kim B.H., Kim D.Y., Oh S., Ko J.Y., Rah G., Yoo K.H, & Park J.H. (2019). Deficiency of calpain-6 inhibits primary ciliogenesis. BMB Reports, 52(10), 619-624.

+ Open protocol

+ Expand

Western Blot Protein Quantification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lung samples were homogenized with a tissue lyser (Qiagen, Hilden, Germany), proteins were isolated using the NucleoSpin® RNA/Protein Kit (Macherey-Nagel, Düren, Germany) and protein concentration was measured with a protein quantification assay (Macherey-Nagel).
20 µg proteins per lane were loaded, fractionated by SDS-PAGE (polyacrylamide gel concentrations in Table 1) and transferred to PVDF membranes (Bio-Rad, Hercules, CA, USA). Membranes were blocked (blocking conditions in Table 1), incubated with the primary antibody, washed, incubated with the secondary antibody (antibody details in Table 1), washed and developed using the Clarity Max™ Western ECL Blotting Substrate (Bio-Rad) and the ChemiDocTM Touch Imager (Bio-Rad). Protein bands intensities were assessed with the Image LabTM Software (Bio-Rad), normalized according to the loading control and expressed as percentage of the CD mean of the respective membrane.

Hollenbach J., Lopez-Rodriguez E., Mühlfeld C, & Schipke J. (2019). Voluntary Activity Modulates Sugar-Induced Elastic Fiber Remodeling in the Alveolar Region of the Mouse Lung. International Journal of Molecular Sciences, 20(10), 2438.

+ Open protocol

+ Expand

Isolation and Quantification of Human Retinal Cell Populations

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primary RPE/choroid and retina were dissected from an unfixed human eye. Retinal cell populations were separated using magnetic-activated cell sorting (MACS) as described in Grosche et al. (33 (link)). Human RPE for cultivation was isolated from healthy donor eyes (age 86 and 65 years) and treated as previously described (34 (link)). ARPE19 cells were purchased from ATCC (LGC Standard GmbH, Wesel, Germany) and cultivated as reported earlier (35 (link)). Human liver cDNA was kindly provided by V. M. Milenkovic (Department of Psychiatry and Psychotherapy, University Regensburg). mRNA of the cells was isolated (NucleoSpin RNA/Protein Kit, Macherey-Nagel, Düren, Germany), and cDNA was synthesized (Quantitect Reverse Transcription Kit, Qiagen, Hilden, Germany). qRT-PCR was performed using Quantitect primer sets (chfr3: QT00001631, cfh: QT00001624, gapdh: QT00079247) and Rotor Gene Sybr green PCR Kit (Qiagen, Hilden, Germany). Taqman PCR was performed using Brilliant III UF MM QPCR/Low ROX master mix (Agilent Technologies, Waldbronn, Germany) and the following cfhr3-specific primer (cfhr3-forward: gtttgcaaaatggatggtca; cfhr3-reverse: ggaggtggtatcaccattgc) and the FAM-labeled probe #25 (Roche Diagnostics, Mannheim, Germany).

Schäfer N., Grosche A., Reinders J., Hauck S.M., Pouw R.B., Kuijpers T.W., Wouters D., Ehrenstein B., Enzmann V., Zipfel P.F., Skerka C, & Pauly D. (2016). Complement Regulator FHR-3 Is Elevated either Locally or Systemically in a Selection of Autoimmune Diseases. Frontiers in Immunology, 7, 542.

+ Open protocol

+ Expand

RNA Isolation and cDNA Synthesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using NucleoSpin^®® RNA/ Protein kit (MACHEREY-NAGEL, Düren, Germany) according to the manufacturer’s instructions. RNA concentration was determined with NanoDrop One spectrophotometer. cDNA synthesis was performed using the qScript™ cDNA Synthesis Kit (Quanta Biosciences, VWR, Darmstadt, Germany) in a thermocycler qTOWER³ G (Analytik Jena AG, Jena, Germany) using qPCRsoft 3.4 (© 2009–2016 © by Analytik Jena AG, Jena, Germany). Samples were incubated at 22 °C for 5 min, at 42 °C for 30 min, at 85 °C for 5 min, followed by cooling at 4 °C for 60 min.

Hedderich J., El Bagdadi K., Angele P., Grässel S., Meurer A., Straub R.H., Zaucke F, & Jenei-Lanzl Z. (2020). Norepinephrine Inhibits the Proliferation of Human Bone Marrow-Derived Mesenchymal Stem Cells via β2-Adrenoceptor-Mediated ERK1/2 and PKA Phosphorylation. International Journal of Molecular Sciences, 21(11), 3924.

+ Open protocol

+ Expand

Multiregional Brain Tissue Sampling

Check if the same lab product or an alternative is used in the 5 most similar protocols

For Western blotting (WB), quantitative real time PCR (qPCR), and post mortem HPLC, and MAO activity assay, rats were decapitated and micropunches were taken bilaterally from 0.5–1 mm thick brain slices from the medial prefrontal cortex (mPFC), orbitofrontal cortex (OFC), thalamus (Thal), hippocampus (Hipp), nucleus accumbens (Nacc), caudate putamen (CPu), globus pallidus (GP) and subthalamic nucleus (STN) as described previously42 . The total RNA and protein was extracted using the NucleoSpin RNA/Protein-Kit (Machery-Nagel, Düven, Germany). For immunostaining, rats were transcardially perfused, brains postfixed in 4% paraformaldehyde and cryosectioned in 40-μm serial coronal frozen sections.

Hadar R., Edemann-Callesen H., Reinel C., Wieske F., Voget M., Popova E., Sohr R., Avchalumov Y., Priller J., van Riesen C., Puls I., Bader M, & Winter C. (2016). Rats overexpressing the dopamine transporter display behavioral and neurobiological abnormalities with relevance to repetitive disorders. Scientific Reports, 6, 39145.

+ Open protocol

+ Expand

Transcriptome Analysis of Adamts3 Knockout

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted with NucleoSpin RNA/protein kit (Machery-Nagel, Germany) according to the manufacturer’s instructions. The RNA quality was evaluated with Eukaryote Total RNA Nano Assay of the Agilent 2100 Bioanalyzer (USA). Transcriptome analyses were performed on Illumina Mouse WG-6 v2.0 chips on total RNA from the liver of Adamts3^+/+ and Adamts3^−/− littermates between E13.5 and E14.5. The raw data were analyzed using the GeneChip Operating software. Additional analyses were also performed with Ingenuity Pathway (Qiagen, USA) or DAVID software [33 (link)].

Janssen L., Dupont L., Bekhouche M., Noel A., Leduc C., Voz M., Peers B., Cataldo D., Apte S.S., Dubail J, & Colige A. (2015). ADAMTS3 activity is mandatory for embryonic lymphangiogenesis and regulates placental angiogenesis. Angiogenesis, 19, 53-65.

+ Open protocol

+ Expand

Quantitative Analysis of Gene Expression in Retinal Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

On D90, retinas (n=4–5) from each group were excised, and tissue RNA was extracted using a NucleoSpin RNA/Protein kit (Macherey-Nagel, USA). The quantity and quality of RNA were determined spectrophotometrically (Nanodrop Technologies, Montchanin, DE). The same amount of total RNA was used for reverse transcription using a ProtoScript(R) II First-Strand cDNA Synthesis Kit according to the standard protocol of the supplier (New England Biolabs, UK). The quantitative PCR amplifications were performed on a ViiA 7 Real-Time PCR System (Applied Biosystems, USA) using Fast SYBR Green Master Mix (Thermo Fisher Scientific, USA) in a reaction volume of 20 µL. Relative quantification analysis was carried out on ViiA seven software. The primer sets for the genes whose differential expression was analysed by Quantitative reverse transcription PCR (qRT-PCR) are shown in table 1. Expression levels of each target gene were normalised to those of β-actin mRNA. Data are reported as the mean relative expression levels ± SE of the mean (SEM).

Prokopiou E., Kolovos P., Kalogerou M., Neokleous A., Papagregoriou G., Deltas C., Malas S, & Georgiou T. (2017). Therapeutic potential of omega-3 fatty acids supplementation in a mouse model of dry macular degeneration. BMJ Open Ophthalmology, 1(1), e000056.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!