The guide (g)RNA sequence targeting Homo sapiens KRIT1 (5′-GTATTCCCGAGAATTGAGACTGG-3′) was selected based on the Zhang lab online gRNA prediction tool (http://crispr.mit.edu/ ). The gRNA was subsequently cloned in lentiCRISPRv2 vector (Addgene; 52961), flanked by Esp3I (New England Biolabs; R0734) restriction sites. Lentiviral particles were produced in HEK 293T cells, which were co-transfected with the gRNA containing lentiCRISPRv2 vector together with the packaging vectors pMDLg/pRRE (Addgene; 12251), pRSV-Rev (Addgene; 12253), and pMD2.G (Addgene; 12259) using polyethyleneimine (Sigma Aldrich; 764604) as a transfection reagent. Supernatants containing viral particles were collected 48 and 72 h post transfection, concentrated with Lenti-X concentrator (Clontech; 631232) and used to infect HUVECs. Transduced HUVECs were selected with 1 μg/ml Puromycin (Sigma Aldrich; P8833).
Lenticrispr v2 vector
Manufactured by Addgene
Sourced in United States
LentiCRISPR v2 vector is a plasmid used for CRISPR-Cas9 gene editing experiments. It contains the Cas9 gene and a guide RNA expression cassette, allowing for the delivery and expression of the CRISPR-Cas9 system in target cells.
Automatically generated - may contain errors
Lab products found in correlation
Pspax2, by Addgene (51 mentions)
Pmd2 g, by Addgene (41 mentions)
Polybrene, by Merck Group (25 mentions)
Puromycin, by Merck Group (22 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (17 mentions)
Lenti x concentrator, by Takara Bio (14 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (14 mentions)
Pcmv vsv g, by Addgene (8 mentions)
Lipofectamine 2000 reagent, by Thermo Fisher Scientific (8 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (7 mentions)
Transit lt1 reagent, by Mirus Bio (7 mentions)
Pvsv g, by Addgene (7 mentions)
Puromycin, by Thermo Fisher Scientific (6 mentions)
Phoenix eco cells, by Mirus Bio (5 mentions)
Puromycin, by InvivoGen (4 mentions)
Lipofectamine 2000 transfection reagent, by Thermo Fisher Scientific (4 mentions)
Lentiguide puro, by Addgene (3 mentions)
Pgem t vector, by Promega (3 mentions)
Bsmb1, by New England Biolabs (3 mentions)
Lenticrispr v2, by Addgene (3 mentions)
305 protocols using lenticrispr v2 vector
1
CRISPR-Cas9 Knockdown of KRIT1 in HUVECs
2
Lenti-CRISPRv2 Vector for Gene Editing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Lenti-CRISPRv2 vector was purchased from the Addgene plasmid repository (Addgene cat #52961) (https://www.addgene.org ). Single guide RNAs were designed using CRISPR design software (http://crispr.mit.edu ) from Zhang’s lab. Oligos corresponding to the sgRNAs were synthesized and cloned into a Lenti-CRISPRv2 vector following the protocol from Addgene. The human sgRNA sequences are shown as follow:
hCPT1A F: CACCGCTCCGGACGGGATTGACCTG
hCPT1A R: AAACCAGGTCAATCCCGTCCGGAGC
hCPT2 F: CACCGCGGGGCCCCGCGGTTGGTCC
hCPT2 R: AAACGGACCAACCGCGGGGCCCCGC
hACAD9 F: CACCGCTTGCCTAAACTGGCGTCCG
hACAD9 R: AAACCGGACGCCAGTTTAGGCAAGC
sgRNA sequencing primer: GAGGGCCTATTTCCCATGATT
Lentiviral particles were packaged in HEK293T cells according to the protocol from Addgene. GBM cells were plated at 1.25 × 105 per well in 12-well plates. After 16 h, the medium was replaced with 0.5 ml lentiviruses and 0.5 ml fresh medium containing 10 ng polybrene (Sigma-Aldrich, Catalog #H9268-10G) for 6–8 h and then add an additional 0.5 ml fresh medium. After 12 h incubation, cells were exchanged to fresh medium and kept culturing for another 48 h. The infected cells were selected with 0.3 μg/ml puromycin for 1 week and confirmed by Western blot.
hCPT1A F: CACCGCTCCGGACGGGATTGACCTG
hCPT1A R: AAACCAGGTCAATCCCGTCCGGAGC
hCPT2 F: CACCGCGGGGCCCCGCGGTTGGTCC
hCPT2 R: AAACGGACCAACCGCGGGGCCCCGC
hACAD9 F: CACCGCTTGCCTAAACTGGCGTCCG
hACAD9 R: AAACCGGACGCCAGTTTAGGCAAGC
sgRNA sequencing primer: GAGGGCCTATTTCCCATGATT
Lentiviral particles were packaged in HEK293T cells according to the protocol from Addgene. GBM cells were plated at 1.25 × 105 per well in 12-well plates. After 16 h, the medium was replaced with 0.5 ml lentiviruses and 0.5 ml fresh medium containing 10 ng polybrene (Sigma-Aldrich, Catalog #H9268-10G) for 6–8 h and then add an additional 0.5 ml fresh medium. After 12 h incubation, cells were exchanged to fresh medium and kept culturing for another 48 h. The infected cells were selected with 0.3 μg/ml puromycin for 1 week and confirmed by Western blot.
3
CRISPR-Mediated BCKDK Knockout in Lung Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
BCKDK knockout (KO) lung cell lines were generated using clustered regularly interspaced short palindromic repeat (CRISPR) genome editing as previously described (24 (link)). The BCKDK single guide RNA (sgRNAs) were designed using the CRISPR Design Tool (http://crispr.mit.edu ; Zhang Laboratory, Massachusetts Institute of Technology, Cambridge, MA, USA) and purchased from Sangon Biotech (Shanghai, China). The BCKDK knockout plasmid was generated by cloning BCKDK sgRNAs into lenti-CRISPR V2 vectors (Addgene, Watertown, MA, USA). The sgRNA sequences are as follows: 5'-CACCGGCCACCGACACACACCACG-3'; 5'-AAACCGTGGTGTGTGTCGGTGGCC-3'. Lentivirus was produced by co-transfecting 293T cells with BCKDK knockout plasmid and packaging vectors (psPAX2 and pMD2G) using lipo3000 (Invitrogen, Carlsbad, CA, USA). A549 and H1299 cells were infected with virus supernatants with 10 µg/mL polybrene (Solarbio, Beijing, China). At 12 h after the infection, change the medium, continue culturing the cells for 24 h, and then, screen the cells with a complete medium containing puromycin (2 µg/mL) (Sigma-Aldrich, St. Louis, MI, USA) every day for approximately 7 days to obtain a stable cell line. Assays were performed with these stable cell lines.
4
SESN2 Gene Knockout Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
sgRNA sequences targeting SESN2 were listed as follows: GCGGGTGGACAACCTGGCGG. Oligos corresponding to the sgRNAs were synthesized and cloned into lenti-CRISPR v2 vectors (Addgene, plasmid #52961). According to our previous study, lentiCRISPRv2-gRNA or lentiCRISPRv2, psPAX2 and pMD2.G were simultaneously co-transfected into HEK293T cell for 48 h to generate lentivirus (Wang et al., 2019 (link)). NRCMs were plated into 35 mm dishes and one milliliter of virus suspension was added into the culture medium. Six hours later, the culture medium was changed into fresh medium. Cultured for another 72 h and western blotting was performed to determine the targets deficient efficiency following.
5
Lentiviral CRISPR/Cas9 Targeting of JHDM1D-AS1
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentivirus CRISPR/Cas9 vectors targeting transcription start site (TSS) regions of JHDM1D-AS1 were constructed using lentiCRISPR v2 vectors (Addgene). Lentiviral particles containing gRNAs were produced using packaging (HEK293Ta) cells according to the manufacturer's instructions (Addgene). Cells were infected with the gRNA lentiviruses with 8 μg/ml Polybrene and subsequently selected using 2 μg/ml puromycin for forward gRNAs and 6 μg/ml blasticidin for reverse gRNAs (Table 5 ).
6
Engineered Cell Lines for NF-kB Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HOIP- and HOIL-1-deficient K562 and HOIP-deficient A549 and HeLa cell lines were prepared by transfecting mRNA encoding gene-specific zinc finger nucleases (Sigma). CYLD-, OTULIN-, A20-deficient, and A20ΔZnF7-expressing cells were prepared by lentiviral transduction with LentiCRISPR v2 vectors (Sanjana et al., 2014 (link)) provided by Feng Zhang (Addgene plasmid #52961). Single cell clones with protein knockout or control clones were verified by western blotting.
7
CRISPR-Cas9 Knockout Screening Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Guide RNAs were designed at the site http://crispr.mit.edu . Then synthesized single-strand guide RNAs (listed in Supplementary Table 2 ) were annealed to form gRNA oligo duplexes and ligated into digested lentiCRISPR v2 vectors (Addgene, Cambridge, MA, USA plasmid #52961; a gift from Feng Zhang) according to the Addgene’s instruction. Lentivirus was generated by co-transfecting HEK 293FT cells with lentiCRISPR v2, psPAX2 (packaging) and pMD2.G (envelope). After 48 h, virus-containing supernatants were collected and added onto the iBMM cells along with polybrene (8 μg ml−1, Sigma). After another 24 h for virus transduction, cells were selected with puromycin (2 μg ml−1), and single-cell colonies were further selected by plating in 96-well plates. Gene knockout colonies were validated by immunoblot. Colonies that still expressed the target proteins were used as negative control lines.
8
Generating Primate-specific CALCB KO Cell Line
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
By using CRISPR-Cas9 system, gRNA sequences are designed to target the primate-specific ERV, MER11B-left element, MER11B-right element adjacent to CALCB for deletion (Figure 5—figure supplements 1 and 2 ). The gRNA sequences (Supplementary file 1 ) were cloned into lentiCRISPR v2 vectors (Addgene 52961) (Sanjana et al., 2014 (link)). HEK293F-derived cells are transfected with plasmids by lipofectamine 3000 transfection kit (Invitrogen L3000-015) according to the manufacturer’s instructions. One and a half days after transfection, cells were placed under puromycin selection for 2 days. After one round of cell passage, isolation of clonal cells is achieved by serial dilutions in 96-well plates. Genotyping PCR with designed primers (Supplementary file 1 ) and Sanger sequencing are used for verification of individual clones to obtain the desired genome edited cell line.
9
GSTT1 Gene Knockout in EndoC-βH1 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two sgRNAs targeting two different loci on GSTT1 gene: sgGSTT1-1 and sgGSTT1-2 and a sgRNA targeting GFP (sgGFP)46 (link) which has no specific targets on the human genome and was used as a control, were cloned into lentiCRISPRv2 vectors (Addgene plasmid # 52961)47 (link). EndoC-βH1 cells were infected with the lentivirus carrying Cas9 and sgRNAs. After 2 days of selection with 1 μg/ml puromycin, western blots were used to validate the knockout efficiency.
10
Targeted Gene Deletion Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The establishment method of targeted gene‐deletion cell lines that participated in this study were constructed as described previously.[17 , 29 ] Briefly, THLE2 cell lines with ZDHHC1‐ZDHHC24 ablation were established by CRISPR‐Cas9 system. The designed small guide RNA (sgRNA) for human ZDHHCs gene were established and cloned into lentiCRISPR v2 vectors(Addgene, Watertown, MA, USA) to create the Cas9/sgRNA‐loaded lentivirus. Small guide RNA (sgRNA) for establishment of knockout THLE2 cells were obtained from Santa Cruz Biotechnology, Inc., as described in Table S2 , Supporting Information. Oligonucleotide for the sgRNAs were packaged into lentiCRISPR v2 vectors digested with BsmBI restriction enzyme. The obtained cell clones‐containing gene deficiency were distinguished by western blotting. Mouse primary hepatocyte with Zdhhc3 deletion cells were directly isolated from global Zdhhc3‐deficient mice. For the establishment of mouse primary hepatocytes with Zdhhc1‐Zdhhc25 knockdown, short hairpin RNA (shRNA) for knockdown expression of Zdhhcs were obtained from Santa Cruz Biotechnology, Inc., as described in Table S3 , Supporting Information, were packed into adenovirus (Addgene, Watertown, MA, USA), respectively.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!