7900ht thermocycler

Manufactured by Thermo Fisher Scientific

Sourced in United States

The 7900HT thermocycler is a high-throughput instrument designed for PCR (Polymerase Chain Reaction) amplification of DNA samples. It features a compact design and is capable of performing fast, reliable, and precise thermal cycling for a wide range of PCR applications.

Automatically generated - may contain errors

Lab products found in correlation

76 protocols using 7900ht thermocycler

Exosomal miRNA Expression Profiling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miRNA expression profiles were determined with a TaqMan miRNA Array Human Card A (Thermo Fisher Sciences, Waltham, MA, USA). Quantitative RT-PCR was performed on an Applied Biosystem 7900 HT thermocycler, in accordance with the manufacturer’s recommended program [31 (link)]. Using SDS2.2 software and Data Assist (version 3.01, Thermo Fisher Sciences, Waltham, MA, USA), the expression of exosomal miRNAs was calculated based on cycle threshold (Ct) values normalized by those of ath-miR-159, which was spiked in each exosomal sample. Data analysis was performed using GeneSpring^® software (Version 12.1, Agilent Technologies, Palo Alto, CA, USA) and R software (https://www.r-project.org, accessed on 27 Arpil 2017). The Benjamini–Hochberg algorithm was used for the estimation of false discovery rates, as we reported previously [31 (link)].

Yoshizawa S., Umezu T., Saitoh Y., Gotoh M., Akahane D., Kobayashi C., Ohyashiki J.H, & Ohyashiki K. (2018). Exosomal miRNA Signatures for Late-Onset Acute Graft-Versus-Host Disease in Allogenic Hematopoietic Stem Cell Transplantation. International Journal of Molecular Sciences, 19(9), 2493.

+ Open protocol

+ Expand

Vector Genome Quantification in DNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

The number of vector genomes per diploid genome was quantified from 80 ng of total DNA by Taqman real-time PCR using a 7900 HT thermocycler (Applied Biosystem, France). The canine β glucuronidase gene was used for standardization. Primers used for vector genome (MTM1) amplification were: 5′- ATAAGTTTTGGACATAAGTTTGC -3′ (forward), 5′-CATTTGCCATACACAATCAA -3′ (reverse) and 5′-CGACGCTGACCGGTCTCCTA -3′ (probe). Primers and probe used for β glucuronidase amplification were: 5′-ACGCTGATTGCTCACACCAA-3′ (forward), 5′-CCCCAGGTCTGCTTCATAGTTG-3′ (reverse) and 5′-CCCGGCCCGTGACCTTTGTGA-3′ (probe) (Applied Biosystem).

Childers M.K., Joubert R., Poulard K., Moal C., Grange R.W., Doering J.A., Lawlor M.W., Rider B.E., Jamet T., Danièle N., Martin S., Rivière C., Soker T., Hammer C., Van Wittenberghe L., Lockard M., Guan X., Goddard M., Mitchell E., Barber J., Williams J.K., Mack D.L., Furth M.E., Vignaud A., Masurier C., Mavilio F., Moullier P., Beggs A.H, & Buj-Bello A. (2014). Gene Therapy Prolongs Survival and Restores Function in Murine and Canine Models of Myotubular Myopathy. Science translational medicine, 6(220), 220ra10.

+ Open protocol

+ Expand

Total RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells at 75% confluence using TRIZOL (Supplementary Data 3) according to the manufacturer’s guidelines. cDNA was synthesized from 1 μg of total RNA using SuperScript™ VILO™ cDNA Synthesis Kit. All reverse transcriptase reactions, including no-template controls, were run on an Applied Biosystem 7900HT thermocycler. The expression for all the genes was assessed using SYBR and all qPCR experiments were conducted at 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95 °C for 15 s and 60 °C for 1 min on a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The specificity of the reactions was verified by melting curve analysis. Measurements were normalized using GAPDH level as reference. The fold change in gene expression was calculated using the standard ΔΔCt method^{70 (link)}. All samples were analyzed in triplicate. A list of primers is available in Supplementary Data 3.

Bianco G., Coto-Llerena M., Gallon J., Kancherla V., Taha-Mehlitz S., Marinucci M., Konantz M., Srivatsa S., Montazeri H., Panebianco F., Tirunagaru V.G., De Menna M., Paradiso V., Ercan C., Dahmani A., Montaudon E., Beerenwinkel N., Kruithof-de Julio M., Terracciano L.M., Lengerke C., Jeselsohn R.M., Doebele R.C., Bidard F.C., Marangoni E., Ng C.K, & Piscuoglio S. (2022). GATA3 and MDM2 are synthetic lethal in estrogen receptor-positive breast cancers. Communications Biology, 5, 373.

+ Open protocol

+ Expand

Gene Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA and proteins were extracted from cells at 75% confluence using TRIZOL (Supplementary Data 6) according to manufacturer’s guidelines. cDNA was synthesized from 1 μg of total RNA using SuperScript™ VILO™ cDNA Synthesis Kit (Supplementary Data 6). All reverse transcriptase reactions, including no-template controls, were run on an Applied Biosystem 7900HT thermocycler. Gene expression was assessed by using FastStart Universal SYBR Green Master Mix (Supplementary Data 6) and all qPCR were performed at 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95 °C for 15 s and 60 °C for 1 min on a QuantStudio 3 Real-Time PCR System (Applied Biosystems). The specificity of the reaction was verified by melting curve analysis. Measurements were normalized using GAPDH level as the reference. The fold change in gene expression was calculated using the standard ΔΔCt method as previously described^{68 (link)}. All samples were analyzed in triplicates.

Srivatsa S., Montazeri H., Bianco G., Coto-Llerena M., Marinucci M., Ng C.K., Piscuoglio S, & Beerenwinkel N. (2022). Discovery of synthetic lethal interactions from large-scale pan-cancer perturbation screens. Nature Communications, 13, 7748.

+ Open protocol

+ Expand

Transcriptional Profiling of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from T cells using TRIzol (Life Technologies). Reverse transcription was performed using the Verso cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR reactions were prepared by using Bio-Rad SYBR green master mix and performed on an Applied Biosystems thermocycler (7900 HT). Primers against murine Ddit3 forward (GGAGCTGGAAGCCTGGTATG) reverse (GGATGTGCGTGTGACCTCTG), Atf4 forward (GCCTGACTCTGCTGCTTA) reverse (GCCTTACGGACCTCTTC), Eif2ak3 forward (ATCGCAGAGGCAGTGGAGTT) reverse (AGGCTGGCATTGGAGTCAGT), and Actb forward (TGTGATGGTGGGAATGGGTCAGAA) reverse (TGTGGTGCCAGATCTTCTCCATGT) were from IDT. Primers for murine Il12b2, Cxcr3, Ifng, Gzmb, Tbx21, Cbfa3, Eif2ak1, Eif2ak2, and Eif2ak4 and human DDIT3 were purchased from QIAGEN. Relative expression was calculated using the ΔΔCt method and normalized to actb levels.

Cao Y., Trillo-Tinoco J., Sierra R.A., Anadon C., Dai W., Mohamed E., Cen L., Costich T.L., Magliocco A., Marchion D., Klar R., Michel S., Jaschinski F., Reich R.R., Mehrotra S., Cubillos-Ruiz J.R., Munn D.H., Conejo-Garcia J.R, & Rodriguez P.C. (2019). ER stress-induced mediator C/EBP homologous protein thwarts effector T cell activity in tumors through T-bet repression. Nature Communications, 10, 1280.

+ Open protocol

+ Expand

Profiling CD8+ T Cell Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human CD8⁺ T cells were cocultured with K32-DLL4 cells for 96 h and positively enriched by MACS column (Invitrogen Kit). Total RNA was isolated from CD8⁺ T cells using TRIzol (Life Technologies). Reverse transcription reaction was performed using Verso cDNA Synthesis Kit (Thermo Scientific). Quantitative PCR reactions were prepared using a Bio-Rad SYBR green master mix and performed on an Applied Biosystems thermocycler (7900 HT). Relative expression was calculated using the ΔΔCt method and normalized to β2M levels. The data represent the mean quantity of mRNA (in-fold) for different T cell markers ± s.e.m. of three or four independent biological replicates. The data were represented in Prism v.9. Pair primers used were:
Human β2-Microglobulin
Forward: 5′-ATGAGTATGCCTGCCGTGTGA
Reverse: 5′-GGCATCTTCAAACCTCCATG
Human IFNγ
Forward: 5′-GACCAGAGCATCCAAAAGAG
Reverse: 5′-GGACATTCAAGTCAGTTACCGAATA
Human Granzyme B
Forward: 5′-CCCTGGGAAAACACTCACACA
Reverse: 5′-GCACAACTCAATGGTACTGTCG
Human Hes-4
Forward: 5′-ACGGTCATCTCCAGGATGT
Reverse: 5′-CGAGCGCGTATTAACGAGAG

Gonzalez-Perez D., Das S., Antfolk D., Ahsan H.S., Medina E., Dundes C.E., Jokhai R.T., Egan E.D., Blacklow S.C., Loh K.M., Rodriguez P.C, & Luca V.C. (2022). Affinity-matured DLL4 ligands as broad-spectrum modulators of Notch signaling. Nature chemical biology, 19(1), 9-17.

+ Open protocol

+ Expand

Real-Time PCR Analysis of Ciliary Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from nasal turbinate biopsy specimens using TriPure Isolation Reagent (Roche, Indianapolis, IN, USA). cDNA was synthesised using 100-ng total RNA and the TaqMan Reverse Transcription Reagents kit (Applied Biosystems, Carlsbad, CA, USA). Real-time PCR was carried out in a 7900 HT thermocycler (Applied Biosystems) using 2× Gene Expression Master Mix (Applied Biosystems). Expression of IFT46, DNAI2, and FOXJ1 was measured using gene-specific TaqMan® Gene Expression Assays (Applied Biosystems, CA, USA). Gene expression was normalised to that of GAPDH and compared according to the ΔΔCt method, as described previously.^{3 (link)}

Mata M., Zurriaga J., Milian L., Reula A., Armengot M., Ruiz-Sauri A, & Carda C. (2021). IFT46 Expression in the Nasal Mucosa of Primary Ciliary Dyskinesia Patients: Preliminary Study. Allergy & Rhinology, 12, 2152656721989288.

+ Open protocol

+ Expand

RNA Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) and cDNA was synthesized using Superscript reverse transcriptase III kit (Life Technologies, Carlsbad, CA, USA) following the manufacturers recommendations. Relative expression was quantified using an ABI 7900HT Thermocycler using SYBR Green Master Mix (Applied Biosystems, Carlsbad, CA) and an annealing temperature of 60°C. Primers used to amplify target genes are listed in S2 Table. All signals were quantified using the ΔCt method and normalized to ΔCt-values of the Actb gene expression levels.

Duque-Afonso J., Smith K.S, & Cleary M.L. (2015). Conditional Expression of E2A-HLF Induces B-Cell Precursor Death and Myeloproliferative-Like Disease in Knock-In Mice. PLoS ONE, 10(11), e0143216.

+ Open protocol

+ Expand

Quantitative miRNA Analysis in Serum Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated from a volume of 400 μL of serum using miRVana PARIS Kit (Ambion), following the manufacturer's protocol. RNA concentration was measured by Nanodrop 2000 spectrophotometer (Thermo Scientific, NY) and stored at -80°C. The cDNA was produced by reverse transcription of a total of 100ng RNA in a thermocycler using TaqMan MicroRNA Reverse Transcription Kit with specific TaqMan probes (Thermo Scientific, NY), following the procedure: incubation for 30 min at 16°C, 30 min at 42°C, and 5 min at 85°C and held at 4°C. qRT-PCR was carried out on an Applied BioSystems 7900HT thermocycler at 95°C for 10min, followed by 40 cycles of 95°C for 15sec and 60°C for 1min. The PCR reaction was repeated in duplicates for each sample. Since there is no consensus on the optimal housekeeping gene in serum, the relative miRNA expression was calculated using the equation 2^-ΔCT, in which ΔCT = cycle threshold (CT) of NSCLC, healthy control or COPD individuals - mean of CT of all healthy controls, which was described by Hu et al. 37 (link). The fold-change of miRNA value was log2 transformed.

Yang X., Zhang Q., Zhang M., Su W., Wang Z., Li Y., Zhang J., Beer D.G., Yang S, & Chen G. (2019). Serum microRNA Signature Is Capable of Early Diagnosis for Non-Small Cell Lung Cancer. International Journal of Biological Sciences, 15(8), 1712-1722.

+ Open protocol

+ Expand

Validating Microarray Findings via RT-PCR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the present study, additional real-time RT-PCR was performed to validate additional genes from several major functional classes altered by injury. The same animal samples and RNA extractions used for microarray analyses were used for RT-PCR. RT-PCR was performed for the following genes: PTGES, PLA2GA2, PLA1A, GDF10, TNC, ASPN, TIMP1, FABP4, LCN2, IL1B, EMR1, PLTP, MOBP, COMT, CRYAB, ARSB, NAAA, PTPRC, AXL and PTAFR. cDNA synthesis was performed using 100 ng total RNA and the TaqMan Reverse Transcription Reagents kit (Applied Biosystems, Carlsbad, CA, USA). Real-time PCR was carried out in a 7900 HT thermocycler (Applied Biosystems) using 2× Gene Expression Master Mix and Assays on Demand (Applied Biosystems). For comparative analysis, the 2^-δδCt method was used [86 (link)].

Avila-Martin G., Mata-Roig M., Galán-Arriero I., Taylor J.S., Busquets X, & Escribá P.V. (2017). Treatment with albumin-hydroxyoleic acid complex restores sensorimotor function in rats with spinal cord injury: Efficacy and gene expression regulation. PLoS ONE, 12(12), e0189151.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!