Plasmid pACT2-GK-PTAP encoding GAD-GK-PTAP was constructed by cloning the human β-cell GCK coding sequence in the BamH1 site of pACT2-PTAP. pACT2-PTAP was generated by inserting a sequence encoding a triple repeat of the PTAP motif (PEPTAPPEPTAPPEPTAPPAE) in the Xho1 site of pACT2 (Clontech) and in frame with the GAD sequence. 2 µm high-copy-number and integrative plasmids encoding LexA-Tsg101 were constructed by cloning the Tsg101 coding sequence in the BamH1 site of LexA(1-202)+PL35 (link) or a pRS40236 (link) derivative containing the LexA sequence under the control of the ADH1 promotor and terminator. pACT2-GK and pGBKT7-GKRP encoding GAD-GK and GBD-GKRP have been described previously37 (link), as well as plasmids expressing GST-GK, GFP-GK, GKRP-Flag and GKRP-mCherry22 (link). Single mutations in pACT2-GK were introduced by site-directed mutagenesis.
Pact2
Manufactured by Takara Bio
Sourced in United States
PACT2 is a laboratory equipment product offered by Takara Bio. It is designed for performing RNA-seq library preparation. The core function of PACT2 is to facilitate the generation of high-quality RNA-seq libraries from a variety of sample types.
Automatically generated - may contain errors
Lab products found in correlation
Pgbkt7, by Takara Bio (9 mentions)
Pbtm116, by Takara Bio (5 mentions)
Human fetal brain cdna library, by Takara Bio (2 mentions)
Pgbt9, by Takara Bio (2 mentions)
Pcdna3, by Thermo Fisher Scientific (2 mentions)
Plexa, by Takara Bio (2 mentions)
Gal4 dna binding domain, by Takara Bio (1 mentions)
Pegfp n1 vector, by Takara Bio (1 mentions)
Pcr xl topo, by Thermo Fisher Scientific (1 mentions)
Pdest27, by Thermo Fisher Scientific (1 mentions)
Pmrfp lc3, by Addgene (1 mentions)
3 amino 1 2 4 triazole 3 at, by Merck Group (1 mentions)
Mav203, by Thermo Fisher Scientific (1 mentions)
Pdest22, by Thermo Fisher Scientific (1 mentions)
Pdest32, by Thermo Fisher Scientific (1 mentions)
Zyg 11, by Thermo Fisher Scientific (1 mentions)
Frozen ez yeast transformation 2 kit, by Zymo Research (1 mentions)
Pas2 1, by Takara Bio (1 mentions)
Klenow fragment, by New England Biolabs (1 mentions)
Rnaeasy kit, by Qiagen (1 mentions)
55 protocols using pact2
1
Plasmid Construction for GAD-GK-PTAP
2
Yeast Two-Hybrid Interaction Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bait and prey were cloned into pACT2 containing the GAL4 activation domain and pBTM166 containing the GAL4 DNA-binding domain (Clontech). Plasmids encoding activation domain fused SSUP-72 (pCZGY2665) or activation domain-only control were cotransformed with plasmids encoding the binding domain fused full-length SYDN-1 (pCZGY2666), the N-terminal half of SYDN-1 (pCZGY2667), or the C-terminal half of SYDN-1 (pCZGY2668) or the binding domain only into the L40 yeast strain and selected on Trp−Leu− plates to obtain cotransformants. Single colonies were picked from each plate and cultured until OD600 = 0.4–1.0. Yeast cells were pelleted by centrifugation, washed twice with ddH2O, and resuspended in ddH2O. Five microliters of yeast cells per spot was plated on Histidine selection plates with or without 1 mM 3AT in a dilution series.
3
Two-Hybrid Screening of EFA-6 Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed two-hybrid screening as described (Wang et al., 2013 (link)). We cloned EFA-6 full-length cDNA and fragments into a pMB27-Gal4-BD-gtwy vector, derived from the pPC97-Gal4-BD vector. We transformed baits into yeast strain Y8930, and mated these to a pPC86-Gal4-AD prey library of mixed-stage C. elegans cDNAs in strain Y8800. Plasmids for two-hybrid experiments are listed in Supplementary file 1B . We screened >2 × 106 independent colonies per bait, and identified interacting cDNAs by plasmid amplification and sequencing. To test specific interactions we cloned the appropriate full length or fragment cDNAs into the pACT2 (Gal4 activation domain) or pBTM116 (LexA DNA-binding domain) vectors (Clontech, Mountain View, CA) and co-transformed constructs into yeast strain L40. We grew transformed yeasts on agar plates with SD medium (synthetic minimal medium) lacking leucine and tryptophan; interactions were examined on plates with SD medium lacking leucine, tryptophan, and histidine, with or without 3-AT.
4
Cloning of EV-A71 Viral Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
2B, 2C, 2BC, 3A, and 3AB genes of EV-A71 were chemically synthesized from GenScript and cloned into the BamHI and EcoRI sites of pEGFP-N1 vector (Clontech, Mountain View, CA, USA) to generate GFP fusion proteins. The STX17 gene was cloned into pGBKT7 (Clontech) and pCherry (Addgene, Cambridge, MA, USA).) vectors while the 2BC gene of EV-A71 was cloned into the pACT2 (Clontech) and pDEST27 (Thermo, Waltham, MA, USA) vectors. The pmRFP-LC3 and LAMP1-YFP vectors were obtained from Addgene. The tandem tagRFP-eGFP-LC3 vector was purchased from Thermo. The EV-A71 41-eGFP infectious cDNA clone was constructed by cloning the full-length genome of the virus with eGFP into pCR-XL-TOPO (Invitrogen, Carlsbad, CA, USA) as previously described [23 (link)].
5
Yeast Two-Hybrid Assay Protocol
6
Yeast Two-Hybrid Screening for RPGRIP1L Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
YTH screen was performed in Saccharomyces cerevisiae strain L40 (trp1-901, his3D200, leu2–3, ade2 LYS2::(lexAop)4-HIS3 URA3::(lexAop)8-lac GAL4) using MyoVa-GTD cloned into pBTM116 (LexA DNA-binding domain, DBD) as bait and a human fetal brain cDNA library (Clontech) cloned into pACT2 (Gal4 activation domain, AD) as prey. Yeast cells were transformed with pBTM116_MyoVa-GTD vector and the library as described by Alborghetti and co-workers47 (link). The screen was performed in solid Synthetic Defined Medium without tryptophan, leucine and histidine (SD-WLH) containing 5 mM 3-amino-1,2,4-triazole (3-AT) (Sigma-Aldrich, St. Louis, MO). To identify the preys, the pACT2 plasmids of positive clones were isolated and sequenced. The DNA sequences were then compared with those available in the NCBI data bank using the BLASTX program48 (link). The clone identified as encoding for the full-length RPGRIP1L isoform c (NP_001295263.1) was further selected for in vitro and in cell validation and characterization.
7
Yeast Two-Hybrid Screening for STC2 Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The yeast strain AH109 and a pretransformed human testis cDNA library in the vector pACT2 (Clontech, CA, USA) were used in the yeast two-hybrid screenings. Yeast extract-peptonedextrose (Clontech) was used as the standard medium for yeast cell culture. As a bait, cDNA corresponding to the mature peptide region of human STC2 (STC2M; Fig. 1 A) was PCR-amplified using forward (5'CGCGAATTCACCGACGCCACCAAC CCA-3') and reverse (5'TCTGATATCCGGAGGTGAGGATC CG CG-3') primers with human STC2 cDNA (gift from Regerone Inc., Chuncheon, Republic of Korea) as a template. The product was subcloned into pGBT9 (Clontech) using primer-derived EcoRI and XhoI sites to construct pGBT9-STC2M.
8
Yeast Two-Hybrid Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The yeast two-hybrid assay was performed as described previously (Xue et al, 2017 (link)). Briefly, the L40 strain was transformed with pBTM116 and pACT2 (Clontech) fusion plasmids, and colonies harboring both plasmids were selected on Yeast complete–Leu–Trp plates. The β-galactosidase activities were measured by a liquid assay.
9
Yeast Two-Hybrid Screening of MLKL Interactors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The N-terminal region (1–178aa) of MLKL was used as a bait to screen a human bone marrow MATCHmaker cDNA library cloned into pACT2 (Clontech, Mountain View, CA, USA) according to the manufacturer's instructions. In brief, the Saccharomyces cerevisiae reporter strain AH109 was sequentially transformed with the plasmid pGBKT7-MLKL (1–178) and the library. The yeast transformants were selected by growth on SD/-His/-Leu/-Trp media. Approximately 9 × 106 transformants were screened. Positive clones were confirmed using a β-galactosidase activity assay. Plasmids harboring interacting cDNAs were isolated from yeast and transformed into E.coli and purified and subjected to sequencing and NCBI BLAST analysis.
10
Yeast Two-Hybrid Experiments for Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Yeast two-hybrid experiments were performed using the GAL4-based transcription system. The following bait vector constructs were generated in pRL865, which is a derivative of pDEST32 (Invitrogen): ZYG-11;class=Gene">ZYG-11 (pRL1973), OMA-1 (pRL1485), and OMA-1 E141K (pRL2277). pGBKT7-derived bait vector constructs: OMA-1N(1-117) (pRL575). The following prey vector constructs were generated in pRL864, which is a pDEST22 (Invitrogen) derivative: PQN-59 (pRL1909) and ZYG-11;class=Gene">ZYG-11 (pRL1972). The following prey constructs were generated in pRL1058, which is a pACT2 (Clontech) derivative: TAF-4 (pRL1368), SPN-4 (pRL2063), MEX-3 (pRL2027), GLD-1 (pRL2022), C27B7.2 (pRL976), DH11.5 (isoform e; pRL938), and OMA-2N (pRL2428). The bait and prey vector controls used were pGBKT7 and pACT2, respectively. Plasmids derived from pACT2 and pGBKT7 are high-copy number and those derived from pDEST22 and pDEST32 are low-copy number. Low-copy number plasmids were used when high-copy number plasmids were toxic or self-activating. Yeast strains AH109 (Clontech) and Mav203 (Invitrogen) were used as indicated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!