Abi prism 7500 pcr system

Total RNA was extracted using the RNeasy Lipid Tissue Mini kit and Qiacube (Qiagen, Valencia, CA) from flash-frozen hind leg biceps femoris skeletal muscle or subcutaneous adipose tissue. cDNA was synthesized using the Quantitect Reverse Transcriptase kit (Qiagen, Valencia, CA) and then used to measure expression of GLUT4, HIF1α, FGF21, PPARγ, MAP1LC3A, and BECN1 by qPCR (ABI Prism 7500 PCR System, Applied Biosystems, Foster City, CA). FastStart Universal Probe Master (Rox) mix assay reagents were purchased from Roche. Primers were purchased from Integrated DNA Technology (IDT) (Coralville, IA). The endogenous control (18S rRNA) was purchased from Applied Biosystems. RT-PCR analysis for TRPC1 transcripts was done with primers from the eighth and ninth exons (forward, 5′-GCAACCTTTGCCCTCAAAGTG and reverse, 5′-GGAGGAACATTCCCAGAAATTTCC) after the EcoRI site (Eurofins MWG Operon, Huntsville, AL).

Total RNA was extracted from fresh-frozen tissues or cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and miRNA molecules were purified using the mirVana miRNA isolation kit (Ambion, Austin, USA) as previously described [38 (link)]. RNA was reverse transcribed using the PrimeScript RT reagent kit (Takara, Dalian, China). qRT-PCR was performed using SYBR Premix Ex Taq II (Takara) on an ABI Prism 7500 PCR system (Applied Biosystems, USA). Data were normalized to β-actin. Mature miR-148a was analyzed by qRT-PCR using the TaqMan MicroRNA Assay Kit (Applied Biosystems). The expression of mature miR-148a was determined by real-time PCR analysis following stem-loop RT and data were normalized to U6 snRNA. Relative expression was measured using the 2^−ΔΔCT method [39 (link)] with the following primers: GADD45A forward: 5′- GAGCAGAAGACCGAAAGCGAC-3′, reverse: 5′-GAATGTGGATTCGTCACCAGC-3′. MiR-148a RT-primer: 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAAAGTT-3′; MiR-148a PCR forward: 5′-GCTAGTGTTCTGAGACACTCCG-3′, PCR reverse: 5′-GTGCAGGGTCCGAGGT-3′. U6 RT-primer: 5′-CGCTTCACGAATTTGCGTGTCAT-3′, U6 PCR forward: 5′-GCTTCGGCAGCACATATACTAAAAT-3′, PCR reverse: 5′-CGCTTCACGAATTTGCGTGTCAT-3′.

Total RNA from renal tissues was isolated by Trizol (Invitrogen). cDNA was obtained by reverse transcription with the High Capacity cDNA Archive Kit (Applied Biosystems). Real-time PCR was performed on an ABI Prism 7500 PCR system (Applied Biosystems) using the DeltaDelta Ct method. Expression of genes of interest was reflected as ratios to Glyceraldehyde 3-phosphate dehydrogenase (GADPH). Pre-developed primers and probes assays: GADPH, arginase I (ArgI), interleukin 10 (IL-10), interferon gamma (IFN-γ), and inducible nitric oxide synthase (iNOS, Applied Biosystems).

The method was as described previously [17 (link)]. Briefly, after total RNA was extracted and complementary DNA (cDNA) was synthesized, qRT-PCR was performed using an ABI Prism 7500 PCR system (Applied Biosystems, USA). β-Actin was used as an internal reference, and the 2^−ΔCt method was used to calculate the relative mRNA expression level. The measurements were repeated in triplicate and averaged. The primers were designed as follows: OCLN: 5’-AAGACGATGAGGTGCAGAAG-3’ (forward), 5’-GTGAAGAGAGCCTGACCAAA-3’ (reverse); ZO1: 5’-GGAGAGGTGTTTCGTGTTGT-3’ (forward), 5’-ACTGCTCAGCCCTGTTCTTA-3’(reverse); β-actin: 5’-CGTGACATTAAGGAGAAGCTG-3’(forward), 5’-CTAGAAGCATTTGCGGTGGAC-3’ (reverse); miR-144: 5'-GCGCGCTACAGTATAGATGATG-3' (forward), 5'-GCTGTCAACGATACGCTACG-3' (reverse).

Total RNA from mouse kidneys was isolated using TRIzol (Invitrogen), and reverse transcription was performed using 500 ng of total RNA in the first-strand cDNA synthesis reaction with PrimeScript RT reagent Kit (Takara). The expression of each gene was determined using an ABI Prism 7500 PCR system (Applied Biosystems). The reaction conditions were as follows: pre-denaturation stage: 95°C for 30s, 1 cycle; amplification: 95°C for 5s, 60°C for 30s, 40 cycles; and dissolution curve analysis stage: 95°C for 15s, 60°C for 1 min, and 95°C for 15s. The primer sequences (forward and reverse) used in this study were as follows: NLRP3 (forward: CGTGAGTCCCATTAAGATGGAGT, reverse: CCCGACAGTGGATATAGAACAGA); GSDMD (forward: GTGTGTCAACCTGTCTATCAAGG, reverse: CATGGCATCGTAGAAGTGGAAG); Caspase-1 (forward: TTTCCGCAAGGTTCGATTTTCA, reverse: GGCATCTGCGCTCTACCATC); IL-18 (forward: TCTTCATTGACCAAGGAAATCGG, reverse: TCCGGGGTGCATTATCTCTAC); and IL-1β (forward: AGCTACGAATCTCCGACCAC, reverse: CGTTATCCCATGTGTCGAAGAA). The gene expression was determined using the 2− ΔΔCT method.

Total RNA was extracted from snap-frozen liver tissues using Trizol Reagent (Thermo Fisher Scientific, 15596-026) and RNeasy RNA Mini Kit (Qiagen, 74104). Complementary DNAs were synthesized using M-MLV Reverse Transcriptase (Life Technologies, 28025-021). QPCR was performed using the ABI Prism 7500 PCR system (Applied Biosystems). 36b4 (gene encoding acidic ribosomal phosphoprotein P0, also called Rplp0) were used for normalization to quantify relative mRNA expression levels. Relative changes in mRNA expression were calculated using the comparative cycle method (2^−ΔΔCt). Primers are listed in Supplementary Table 1.

Total RNA from tissues or cells was isolated using Trizol (Takara Biotech Japan) and evaluated by NanoDrop ND-1000 (Thermo Fisher Scientific, Waltham, MA, USA). Then, total RNA was transcribed into cDNA using a PrimeScript RT Kit (Takara Biotech, Japan) at 37 °C for 15 min and 85 °C for 5 s. RT-qPCR was performed by ABI Prism 7500 PCR system and SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA). The relative expression levels were calculated by 2^−ΔΔCT. GAPDH was used as an internal control. The primer sequences were listed: MALAT1, forward: 5′-ATGCGAGTTGTTCTCCGTCT-3′, reverse: 5′-TATCTGCGGTTTCCTCAAGC-3′; GAPDH, forward: 5′-GGAGTCCACTGGTGTCTTCA-3′, reverse: 5′-GGGAACTGAG CAATTGGTGG-3′.