Pmd2 g vsv g envelope expressing plasmid

Manufactured by Addgene

The PMD2.G VSV-G envelope expressing plasmid is a laboratory tool used for the production of lentiviral vectors. The plasmid contains the genetic sequence for the VSV-G envelope protein, which is commonly used to pseudotype lentiviral particles. This plasmid can be used in conjunction with other lentiviral packaging components to generate recombinant lentiviral particles.

Automatically generated - may contain errors

Lab products found in correlation

Pspax2, by Addgene (2 mentions) 293ft cell, by Thermo Fisher Scientific (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Lenticrispr egfp sgrna 1, by Addgene (1 mentions) Pspax 2 lentiviral packaging plasmid, by Addgene (1 mentions) Bp clonase 2 enzyme, by Thermo Fisher Scientific (1 mentions) Lr clonase 2 plus enzyme, by Thermo Fisher Scientific (1 mentions) Sanger sequencing, by Eurofins (1 mentions) Nucleospin gel and pcr clean up kit, by Macherey-Nagel (1 mentions) Tlrl chq, by InvivoGen (1 mentions) 293t cell, by American Type Culture Collection (1 mentions) Jetprime transfection reagent, by Polyplus Transfection (1 mentions)

5 protocols using pmd2 g vsv g envelope expressing plasmid

Lentiviral Overexpression of Murine LIF

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine LIF ORF (NM_008501.2) was purchased from GenScript and cloned into the pCSII-EF1α-IRES2-bsr lentiviral backbone. Lentiviral packaging plasmid psPAX2 (Addgene, plasmid #12260) and VSV-G envelope expressing plasmid PMD2.G (Addgene, plasmid #12259) were gifts from Didier Trono. 293FT cells were transfected with lentiviral DNA using the calcium phosphate method. Virus was concentrated from media using PEG Virus Precipitation Kit (Sigma). Viral titer was determined by QuickTiter Lentivirus Associated HIV p24 Titer Kit (Cell Biolabs, INC). Mice were infected by tail vein injection with 4 × 10⁹ viral particles before killing on day 7 for immunofluorescence experiments or on day 10 for all other experiments.

Barisas D.A., Kabir A.U., Wu J., Krchma K., Kim M., Subramanian M., Zinselmeyer B.H., Stewart C.L, & Choi K. (2023). Tumor-derived interleukin-1α and leukemia inhibitory factor promote extramedullary hematopoiesis. PLOS Biology, 21(5), e3001746.

+ Open protocol

+ Expand

Silencing GOT1 in Pancreatic Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

PDA cell lines Pa-Tu-8902, MIA PaCa-2, and Capan-1 were either transfected with plentiCRISPR-sgGOT1 (A gift from David Sabatini, Addgene 72874) using Lipofectamine 3000 (Invitrogen) or viral transduction using lentiviral particles of plentiCRISPR-sgGOT1 produced in 293FT cells (Thermo Fisher) by FuGENE 6 Tranfection Reagent (Promega) and lentiviral packaging plasmid psPAX2 (Addgene, 12260) and VSV-G envelope expressing plasmid pMD2.G (Addgene,12259) (Gifts from Didier Trono). Puromycin selected and pooled stable cells were then subject to cellular assays and western blot analysis.

Kremer D.M., Nelson B.S., Lin L., Yarosz E.L., Halbrook C.J., Kerk S.A., Sajjakulnukit P., Myers A., Thurston G., Hou S.W., Carpenter E.S., Andren A.C., Nwosu Z.C., Cusmano N., Wisner S., Mbah N.E., Shan M., Das N.K., Magnuson B., Little A.C., Savani M.R., Ramos J., Gao T., Sastra S.A., Palermo C.F., Badgley M.A., Zhang L., Asara J.M., McBrayer S.K., di Magliano M.P., Crawford H.C., Shah Y.M., Olive K.P, & Lyssiotis C.A. (2021). GOT1 inhibition promotes pancreatic cancer cell death by ferroptosis. Nature Communications, 12, 4860.

+ Open protocol

+ Expand

CRISPR-mediated PHGDH knockout in SKOV3 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

LentiCRISPR transfer plasmid (Addgene Plasmid 49535), LentiCRISPR- EGFP sgRNA 1 (Addgene Plasmid 51760), PMD2.G VSV-G envelope expressing plasmid (Addgene Plasmid 12259), and PsPAX.2 lentiviral packaging plasmid (Addgene Plasmid 12260) were purchased. The target sequence of the sgRNA is GCTCTGAGCCTCCTTGGTGC (exon 8 of PHGDH). The plasmids were virally transfected into HEK293T cells using polyethylemine (PEI) (Polysciences, Inc) and transduced into SKOV3 cells as previously described (Shalem et al. 2014 (link)). Single-cell colonies of puromycin-resistant cells were selected and validated by western blotting.

Wang Q., Liberti M.V., Liu P., Deng X., Liu Y., Locasale J.W, & Lai L. (2016). Rational design of selective allosteric inhibitors of PHDGH and serine synthesis with in vivo activity. Cell chemical biology, 24(1), 55-65.

+ Open protocol

+ Expand

Cloning and Sequencing of S. Typhimurium SspH2

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

S. Typhimurium sspH2 was PCR amplified from genomic SL1344 DNA using the primers GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGCCCTTTCATATTGGAAGC and GGGGACCACTTTGTACAAGAAAGCTGGGTTCAGTTACGACGCCACTGAACG. The sspH2 amplicon was purified by means of a Nucleospin® Gel and PCR clean-up kit (Macherey-Nagel) according to the manufacturers' instruction and cloned into the Gateway® pDONR221 and pMET7-GAG-SP1 (22 (link)) using BP Clonase II Enzyme (Invitrogen) and LR Clonase II Plus Enzyme (Invitrogen), respectively. The pMD2.G (VSV-G envelope-expressing plasmid; Addgene, plasmid no. 12259) and pcDNA3-FLAG-VSV-G (Addgene, plasmid no. 80606) plasmids were retrieved from Addgene and the pSVsport vector was obtained from Life Technologies. The correctness of the sspH2 insert was confirmed by Sanger sequencing (Eurofins).

De Meyer M., Fijalkowski I., Jonckheere V., De Sutter D., Eyckerman S, & Van Damme P. (2021). Capturing Salmonella SspH2 Host Targets in Virus-Like Particles. Frontiers in Medicine, 8, 725072.

+ Open protocol

+ Expand

Lentiviral Particle Production in 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

293T cells (ATCC) were plated onto 0.0005% poly-L-lysine-coated 6 cm dishes (Sigma P4832) and then transfected the following day using the JetPRIME transfection reagent (Polyplus) pMD2.G VSV-G envelope expressing plasmid (Addgene plasmid #12259), psPAX2 second-generation lentiviral packaging plasmid (Addgene plasmid #12260) along with the relevant experimental vector, and 5-uM chloroquine (InvivoGen #tlrl-chq).

Steadman K., You S., Srinivas D.V., Mouakkad L., Yan Y., Kim M., Venugopal S.V., Tanaka H, & Freeman M.R. (2023). Autonomous action and cooperativity between the ONECUT2 transcription factor and its 3′ untranslated region. Frontiers in Cell and Developmental Biology, 11, 1206259.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!