Sirna transfection reagent

Human hepatocellular carcinoma cell lines (MHCC-97H, HEPG2, Huh-7) and human normal hepatocytes (LX2) were purchased from the American Type Culture Collection (ATCC). All cells were maintained in DMEM medium (Gibco, Grand Island, USA) containing 10% fetal bovine serum (Gibco, Grand Island, USA) and 1% penicillin–streptomycin (Gibco, Grand Island, USA) and incubated at 37 °C and 5% CO2. PRDX1- siRNA was obtained from Sangon Biotech, Shanghai, China (Shanghai, China) for silencing the expression of PRDX1. In this study, the PRDX1-siRNA sequence was: sense:5′- GCACCAUUGCUCAGGAUUATT -3′; antisense:5′- UAAUCCUGAGCAAUGGUGCTT -3′. Cells were seeded at a density of 6 × 104 cells/well in 12-well plates and transfected after 24 h. PRDX1-siRNA/ NC-siRNA was transfected using siRNA transfection reagent (Polyplus, France) to a final concentration of 20 nM. Finally, the expression levels of target proteins in cells transfected for 72 h were analyzed. The successfully transfected cells will be used for subsequent experiments.

DNA2 siRNA duplexes were purchased from Life Technologies (cat#31053582). The siRNA transfection reagent was purchased from Polyplus Transfection. siRNA‐mediated knockdown of DNA2 was done following the manufacturer's instructions. Briefly, cells were grown to 30–40% confluence and washed with FBS‐ and antibiotic‐free medium. siRNA duplexes were mixed with FBS‐ and antibiotic‐free medium and incubated with transfection reagent for 10 min. This siRNA/reagent mixture then was added to cells in FBS‐ and antibiotic‐free medium. After 5–7 h of incubation, cells were incubated for 72 h in a final concentration of 10% FBS and 1% penicillin/streptomycin added into the transfection medium before cell harvesting.

Cells were seeded into 12‐well plates (5 × 10⁴ cells per well for HUVECs and 6 × 10⁴ cells per well for HK‐2) and grown to ≈50% confluence. Then, the cells were transfected with control siRNA (negative control) or siRNA against ATG5, ATG7, SIGMAR1 or NOTCH1 using siRNA Transfection Reagent (409‐10, Polyplus‐transfection, Illkirch, France) according to the manufacturer's instructions. The following siRNAs were purchased from GenePharma (Shanghai, China).

siRNA targeting ATG5, 5′‐CAUCUGAGCUACCCGGAUAdTdT‐3′;

siRNA targeting ATG7, 5′‐GCCGUGGAAUUGAUGGUAUUUdTdT‐3′;

siRNA targeting NOTCH1, 5′‐CCGGGACAUCACGGAUCAUAU‐3′;

siRNA targeting SIGMAR1, 5′‐GACUUCCUCACCCUCUUCUAU‐3′;

siRNA targeting USP13 #1, 5′‐CGACGAUUAUGAAUAUGAAGA‐3′;

siRNA targeting USP13 #2, 5′‐GCGACAGGGUCUACAAGAACG‐3′;

siRNA targeting negative control, 5′‐UUCUCCGAACGUGUCACGUdTdT‐3′.

The normal lung cell line BEAS-2B and seven lung cancer cell lines (H1299, A549, H460, H23, H838, PC-9, and H1975) were purchased from the American Type Culture Collection (ATCC) and maintained in 1640 medium containing 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA) and 1% penicillin–streptomycin (Gibco, Grand Island, NY, USA) and cultured at 37 °C with 5% CO₂. The siRNA of RRM2 was purchased from Sangon Biotech (Shanghai, China) was used to silence the expression of RRM2. In this study, the sequence of RRM2 siRNA was sense: 5'- GCGAUUUAGCCAAGAAGUUTT-3'. H1975 cells were seeded in 12-well plates at a density of 6 × 10⁴ cells/well and transfected 24 h later. RRM2 siRNA or negative control (NC) siRNA was transfected to a final concentration of 20 nM using an siRNA transfection reagent (Polyplus, France). Finally, the transfected cells were detected after48h.

Transfection of HeLa cells was conducted with siRNA transfection reagent of jetPRIME (Polyplus, New York, NY, USA) following the manufacturer's instructions. High-purity controls (scrambled RNA), along with DR5, DR4, and Atg7, were obtained from GenePharma. The targeting sequences of the siRNA constructs were DR5 siRNA, 5′-UUCUGGGAACACGAGCAACAG-3′; DR4 siRNA-1, 5′-AAGAACCA GCAGAGGUCACAA-3′; DR4 siRNA-2, 5′-CACCAAUGCUUCCAACAAUdTdT-3′; Atg7 siRNNA-1, 5′-CCCUGUACUCCUCAACAAG-3′; and Atg7 siRNA-2, 5′-GCCUCUCUAUGAGUUUGAA-3′.

Ishikawa cell line (Shanghai Huiying, Shanghai, China) and HEC-1A cell line (Genechem, Shanghai, China) were cultured in α-MEM medium (Bioind, Kibbutz Beit Haemek, Israel) and McCoy’s 5A medium (Bioind), respectively. The medium contained 10% fetal bovine serum (FBS) (Bioind) and 1% penicillin–streptomycin (Invitrogen). All cells were cultured in a humidified incubator at 37 °C with 5% CO₂. BTG1’s overexpression plasmid and knockdown plasmid were purchased from GeneChem (Shanghai, China), and both were transfected with jetPRIME^® in vitro DNA and siRNA Transfection Reagent (PolyPlus-transfection, France) for subsequent experiments. The related sequences can be found in Additional file 2: Table S2.

A lung cancer cell H838 was purchased from American Type Culture Collection (ATCC) and maintained in 1640 medium containing 10% fetal bovine serum (Gibco, Gland Island, USA) and 1% penicillin-streptomycin (Gibco, Gland Island, USA) and cultured at 37°C with 5% CO₂. BNIP3-siRNA from Sangon Biotech (Shanghai, China) was used to silence the expression of BNIP3. In this study, the sequence of BNIP3-siRNA is sense: 5′- GAUUACUUCUGAGCUUGCATT -3′. H358 cells were seeded in 12-well plates at a density of 5 × 10⁴ cells/well and transfected 24 hours later. BNIP3-siRNA or NC-siRNA was transfected to a final concentration of 20 nM using siRNA transfection reagent (Polyplus, France). Finally, the transfected cells were detected after 48 hours.