Hrp labeled secondary antibody
HRP-labeled secondary antibodies are a type of laboratory equipment used in various immunoassay techniques. They are designed to detect and amplify the signal of target proteins or analytes in a sample. The core function of these antibodies is to bind to primary antibodies that have already attached to the target, and the horseradish peroxidase (HRP) enzyme label they carry can then be used to generate a colorimetric or chemiluminescent signal, allowing for the quantification or visualization of the target.
Lab products found in correlation
52 protocols using hrp labeled secondary antibody
Lung Protein Extraction and Western Blot
Neuronal Markers and Signaling Pathways
Rofecoxib-Induced Neuroinflammatory Responses
Isolation and Characterization of Bioactive Compounds
Western Blot Analysis of Cell Markers
Western Blot Analysis of OPG and RANKL
Regulation of FOXO3a in Cancer Stem Cells
LV-RNAi1: 5′- GCACAACCTGTCACTGCATAG-3′
LV-RNAi2: 5′- GACTTCCGTTCACGCACCAATTCTA -3′
LV-RNAi3: 5′- GAGAACAAGCCAGCTACCTTCTCTT -3′
Scrambled sequence 5′-TTCTCCGAACGTGTCACGTAA-3′
Western Blot Analysis of Pancreatic Cells
Immunoblot Analysis of EMT Markers
Western Blot Analysis of MAG Protein
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!