Quantitative real-time PCR (qRT-PCR) was employed to validate the reliability of gene expression using the RNA-seq data. The assay was performed in a Real-Time System Thermocycler using FastFire qPCR PreMix (Tiangen, Beijing, China). The conditions of the qRT-PCR amplification were as follows: initial denaturation at 95 °C for 3 min, followed by 40 cycles for 10 s at 95 °C, 15 s at 58 °C and 20 s at 72 °C. All reactions were performed in triplicates with specific primers (Supplementary Table S11 ), and β-actin was used as the reference gene. The relative gene expression level was calculated using the delta-delta Ct (2−ΔΔCT) method60 .
Fastfire qpcr premix
Manufactured by Tiangen Biotech
Sourced in China, United States
FastFire qPCR PreMix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains all the necessary reagents, including a hot-start DNA polymerase, dNTPs, and buffer components, to perform qPCR experiments.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (5 mentions)
Fastking rt kit, by Tiangen Biotech (3 mentions)
Quantstudio 3 real time pcr system, by Thermo Fisher Scientific (3 mentions)
Tianscript 2 rt kit, by Tiangen Biotech (3 mentions)
Rnasimple total rna kit, by Tiangen Biotech (3 mentions)
Trizol, by Beyotime (2 mentions)
Triquick reagent, by Solarbio (2 mentions)
Rnasimple kit, by Tiangen Biotech (2 mentions)
Viplex fluor real time pcr system, by Vivantis Technologies (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Cfx96 real time pcr system, by Bio-Rad (2 mentions)
Sybr green, by Tiangen Biotech (1 mentions)
Fastquant cdna reverse transcriptase kit, by Tiangen Biotech (1 mentions)
Total rna miniprep kit, by Corning (1 mentions)
Abi stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Viral dna kit, by Omega Bio-Tek (1 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Rnaprep pure plant kit, by Tiangen Biotech (1 mentions)
Abi 7500, by Bio-Rad (1 mentions)
36 protocols using fastfire qpcr premix
1
Validating Gene Expression by qRT-PCR
2
Quantitative RT-PCR Analysis of Macrophage Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from human primary macrophages or raw 264.7 macrophages after tenascin‐c exposure using Trizol Reagent according to the manufacturer's instructions (Biostar, Shanghai, China). About 5 μg total RNA for each sample was reverse‐transcribed into first strand cDNA for qRT‐PCR analysis. The qRT‐PCR was performed at a final volume of 10 μl which contained 5 μl of FastFire qPCR PreMix (Tiangen, Beijing, China), 1 μl of cDNA (1:50 dilution) and 2 μl each of the forward and reverse primers (1 mM). The following qRT‐PCR steps were performed: 94°C for 2 min. for the initial denaturation; 94°C for 20 sec., 58°C for 15 sec. and 72°C for 15 sec., with 2 sec. for plate reading for 40 cycles; and a melt curve from 65 to 95°C. Β‐actin was used to normalize the gene expression. Detailed primer sequences used are listed in Table 1 .
3
Quantifying PL3 Gene Expression in Cotton Under Verticillium Infection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine the in planta expression of PL3 genes, cotton seedlings were root inoculated with 5 × 106 conidia/mL of a V. dahliae suspension. Whole plants were harvested at 3, 5, 7, 9, and 14 days post inoculation (dpi) and flash frozen in liquid nitrogen for RNA extraction using a Total RNA Miniprep Kit (Axygen, Tewksbury, MA, USA) and cDNA synthesis using a FastQuant cDNA Reverse Transcriptase Kit (TianGen, Beijing, China). Quantitative reverse transcription-PCR (qRT-PCR) was performed to identify expression levels of PCWDE genes affected by T-DNA insertion using the FastFire qPCR premix, SYBR Green (TianGen, Beijing, China), and relative gene expression levels were calculated using the 2-ΔΔCT method (Livak and Schmittgen, 2001 (link)) with the β-tubulin gene (VDAG_10074, VdLs.17) as an internal control. All primers are listed in Supplementary Table S3 ; real-time PCR conditions comprised an initial 94°C denaturation step for 10 min, followed by 40 cycles at 94°C for 15 s and at 60°C for 1 min.
4
Quantifying MALAT1, miR-503, and TLR4 in Blood
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from peripheral blood mononuclear cells (PBMCs), hPASMCs, and subject plasma using TRIzol reagent (Thermo Fisher Scientific, Shanghai, China). The RNA was reverse transcribed to cDNA using All-in-One miRNA First-Strand cDNA Synthesis Kits (GeneCopoeia, Rockville, MD, USA). Sequences of interest were amplified using FastFire qPCR PreMix (Tiangen Biotech, Co., Beijing, China) on an ABI StepOne Real-Time PCR System (Thermo Fisher Scientific, Shanghai, China), and using primers for MALAT1 (forward, 5’-GCA GGC GTT GTG CGT AGA G-3’; reverse, 5’-TTG CCG ACC TCA CGG ATT-3’), miR-503 (forward, 5’-TGC CCT AGC AGC GGG AAC-3’; reverse, 5’-ACC CTG GCA GCG GAA ACA ATA-3’) TLR4 (forward, 5’-GAT AGC GAG CCA CGC ATT CA-3’; reverse. 5’-TTA GGA ACC ACC TCC ACG CA-3’), U6 (forward, 5’-CTC GCT TCG GCA GCA CA-3’; reverse, 5’-TGG TGT CGT GGA GTC G-3’), and GAPDH (forward, 5’-GGG TGA TGC AGG TGC TAC TT-3’; reverse, 5’-GGC AGG TTT CTC AAG ACG GA-3’). The expression of lncRNA MALAT1 and miR-503 relative to U6, and the expression of TLR4 mRNA relative to GAPDH mRNA were calculated using the 2−Ct method.
5
Quantitative detection of viral DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Non-encapsidated genomic DNA was removed by treatment with TURBO DNase (Ambion, Austin, TX, USA) at 37 °C for 1 h. The total encapsidated genomic DNA was extracted using a Viral DNA Kit (Omega Biotek). The virus genome copy numbers in cell culture media, cells, rearing water and larvae in vivo were determined by a SYBR green-based real-time quantitative PCR assay with FastFire qPCR PreMix (Tiangen Biotech). A series of known concentrations of linear plasmids with pUCA were used to construct a standard curve. The set of primers used annealed to the conserved region of the viral NS1 gene. These procedures were performed essentially as described previously [18 (link)]. The sequences of primers used in the PCR and qPCR are shown in Additional file 1 : Table S1.
6
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time quantitative reverse transcription PCR (qRT-PCR) was used for gene expression analysis. Briefly, RNA was isolated using a RNAprep pure plant kit (Tiangen, China). cDNA was synthesized using a PrimeScript™ II 1st strand cDNA synthesis kit (TAKARA, Japan). qRT-PCR was carried out using FastFire qPCR PreMix(SYBR Green) (Tiangen, China) on an ABI Stepone plus system (CA, USA). Primers used were listed in Table S1
7
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All steps in RNA extraction should be performed on ice. Total RNA was extracted by TRIzol reagent (Transgen, China). Each group was quantified to 1g by NanoDrop 2000 (Thermo, USA) to standardize. The reverse transcription kit (Tiangen, China) was used for reverse transcription of RNA into cDNA according to its protocol. qRT-PCR was performed on ABI7500 (Bio-Rad, USA) using FastFire qPCR PreMix (Tiangen, China). GAPDH acts as a housekeeping gene to standardize mRNA from different cell lines. △△CT was used as the mathematical method for comparison between diverse groups. The primers in use are as follows:
GAPDH
Forward: ACGGGAAGCTCACTGGCATGG
Reverse: GGTCCACCACCCTGTTGCTGTA
RBMS3
Forward: GGGGAACAGTTGAGTAAAACCA
Reverse: ACAATTTTTCCATACGGTTGGCA
GAPDH
Forward: ACGGGAAGCTCACTGGCATGG
Reverse: GGTCCACCACCCTGTTGCTGTA
RBMS3
Forward: GGGGAACAGTTGAGTAAAACCA
Reverse: ACAATTTTTCCATACGGTTGGCA
8
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA from lung tissues and cells was acquired using the RNA Extraction Kit (N065, China). Next, to quantify the mRNA expression, cDNA synthesis was conducted in line with instructions of the cDNA first chain synthesis kit (N118, China) and miRNA cDNA first-strand synthesis kit (KR211, China), respectively. Then, cDNA was amplified and quantitatively analyzed by the FastFire qPCR PreMix (FP207-02, Tiangen) in a C1000 Touch PCR system (E1138, Bio-Rad, USA). GAPDH and U6 were employed for normalization controls. The results were normalized by the 2-ΔΔCt method [20 (link)]. The primers were listed in Table 1 .
9
Quantifying Cardiac Inflammation Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from cardiomyocytes and H9C2 cells was extracted with Trizol™ Plus RNA Kit (ThermoFisher Scientific, IS10007, Waltham USA) and then reverse transcribed into cDNA (Superscript II reverse transcriptase, Life Technologies). The relative levels of circDiaph3, miR-338-3p, IL-1β, IL-6, TNF-α, and β-actin were determined with FastFire qPCR PreMix (SYBR Green, Tiangen, FP207, China) in a ProFlex™ PCR system (ThermoFisher Scientific) using the standard curve method. Each PCR mixture was initially denatured at 95 °C for 5 min and then cycled 40 times at 95 °C for 10 s, 60 °C for 15 s, and 72 °C for 8 s. The expression of genes was normalized to β-actin or U6 and calculated by 2−ΔΔCt method. Primer sequences used in this study are given in Table 1 .
Primer sequences used in the study
| Primer name | Sequence (5’-3’) |
|---|---|
| circDiaph3 (Forward) | TGAATAACTTCAGAACCACATT |
| circDiaph3 (Reverse) | CTCCTGTCTCATCACCCT |
| miR-338-3p (Forward) | ATCCAGTGCGTCTCGTG |
| miR-338-3p (Reverse) | GTCGTTGCTTGGTTCTCCTTGT |
| IL-1β (Forward) | GCACTACAGGCTCCGAGATGAA |
| IL-1β (Reverse) | GTCGTTGCTTGGTTCTCCTTGT |
| IL-6 (Forward) | CTTGGGACTGATGCTGGTGACA |
IL-6 (Reverse) TNF-α (Forward) TNF-α (Reverse) | GCCTCCGACTTGTGAAGTGGTA CCGCTCGTTGCCAATAGTGATG CATGCCGTTGGCCAGGAGGG |
| β-actin (Forward) | AGCCACATCGCTCAGACAC |
| β-actin (Reverse) | GCCCAATACGACCAAATCC |
| U6 (Forward) | TGCTATCACTTCAGCAGCA |
| U6 (Reverse) | GAGGTCATGCTAATCTTCTCTG |
10
Circular RNA circ_0000376 Stability Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNAsimple reagents (Tiangen, Beijing, China) were used for RNA extraction. RNA was incubated with RNase R (Xiyuan Biotechnology, Shanghai, China) to analyze circ_0000376 stability, regarding untreated cells as controls (mock). Reverse transcription was carried out using FastKing RT Kit (Tiangen) and MicroRNA RT reagents (Thermo Fisher). Then, FastFire qPCR PreMix (Tiangen) was utilized to analyze gene expression. Finally, results were analyzed with the 2−∆∆Ct method with GAPDH and U6 as controls. The primer sequences are displayed as follows: circ_0000376 5′-ATGAAGGCTAGTTTGGAT-3′ and 5′-TAGTCAGGCATAGTGAAG-3′; miR-545-3p 5′-ACACTCCAGCTGGGTCAGCAAACATTTATT-3′ and 5′-TGGTGTCGTGGAGTCG-3′; PDPK1 5′-AGCATCAGTCCGAACCAT-3′ and 5′-GAGTTCCAGGACCACAGC-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!