Nucleospin 96 plasmid kit

Manufactured by Macherey-Nagel

The NucleoSpin 96 Plasmid kit is a laboratory equipment designed for the rapid and efficient isolation of plasmid DNA from bacterial cultures. It utilizes a silica-based membrane technology to bind and purify plasmid DNA, which can then be used for various downstream applications such as sequencing, cloning, or transfection.

Automatically generated - may contain errors

Lab products found in correlation

Top10 competent cell, by Thermo Fisher Scientific (1 mentions) Cloneamp polymerase, by Takara Bio (1 mentions) Epmotion 5075 liquid handling workstation, by Eppendorf (1 mentions) Amicon ultra column, by Merck Group (1 mentions) Protein g spin columns, by Thermo Fisher Scientific (1 mentions) Dh5a cells, by New England Biolabs (1 mentions) Gateway reaction, by Thermo Fisher Scientific (1 mentions) Lr clonase 2, by Thermo Fisher Scientific (1 mentions) E coli top10 cells, by Thermo Fisher Scientific (1 mentions) Carbenicillin, by Merck Group (1 mentions)

6 protocols using nucleospin 96 plasmid kit

High-throughput Kozak Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For performing Kozak high-throughput mutagenesis, oligos with random bases at the Kozak positions −4 to −1 and +4 were used. The pool of fragments with mutated Kozaks of unknown identity was ligated into the Tandem RLuc-FLuc reporter. Colonies were picked and processed using the Nucleospin96 Plasmid kit (Macherey-Nagel). The identity of each of the purified plasmids was determined by sequencing.

Acevedo J.M., Hoermann B., Schlimbach T, & Teleman A.A. (2018). Changes in global translation elongation or initiation rates shape the proteome via the Kozak sequence. Scientific Reports, 8, 4018.

+ Open protocol

+ Expand

Mutagenic Library Generation Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutagenic libraries were generated on Ace-mNeon-T2A-NLS-mCherry and VARNAM-T2A-NLS-mCerulean backbones using a pre-established protocol (18 (link)). Briefly, a set of 4 forward primers, containing degenerate codons WKC, NMC, VWG, or DGG at the target site, was pooled with a single, partially overlapping reverse primer, and mutagenizing PCR reactions were set up using CloneAmp^™ polymerase (Clontech). Following DpnI treatment to digest unmutated template, the linear PCR products were circularized using InFusion^® ligase (Clontech) and transformed in TOP10 competent cells (Invitrogen). To obtain up to 19 unique AA substitutions at a single target site, 48 colonies were picked and cultured in 96 deep-well culture plates. Plasmid DNA was isolated using Nucleospin^® 96 Plasmid kit (Macherey-Nagel) on an epMotion 5075 liquid handling workstation (Eppendorf), and purified DNA was collected in 96-well plates. The libraries were sequenced after voltage screening to identify the individual mutations and ensure at least 19 variants were obtained at every site.

Kannan M., Vasan G., Haziza S., Huang C., Chrapkiewicz R., Luo J., Cardin J.A., Schnitzer M.J, & Pieribone V.A. (2022). Dual-polarity voltage imaging of the concurrent dynamics of multiple neuron-types. Science (New York, N.Y.), 378(6619), eabm8797.

+ Open protocol

+ Expand

Cloning PDZ Domains and NS5 Proteins

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

All PDZ domains (257/266 PDZ) and ORFs containing PDZ domains (91 full-length proteins out of the 152 human proteins) were introduced into Gateway destination vector pYN2H-LEU-N1^{45 (link)} whereas NS5 and NS5∆PBM (NS5 with a deletion of the three residues –TVL–) were introduced into Gateway destination vector pYN2H-TRP-N2, via LR clonase-mediated Gateway reaction (Life Technologies), following the protocol previously described^{46 (link)}. Briefly, LR reaction products were subsequently transformed into DH5α competent bacterial cells and grown for 24 h at 37 °C at 900 rpm in carbenicillin-containing TB liquid medium. Plasmid DNA was extracted using a NucleoSpin 96 Plasmid kit from Macherey–Nagel, following manufacturer's instructions. All DNA were sequenced using plasmid-specific primers.

Giraud E., del Val C.O., Caillet-Saguy C., Zehrouni N., Khou C., Caillet J., Jacob Y., Pardigon N, & Wolff N. (2021). Role of PDZ-binding motif from West Nile virus NS5 protein on viral replication. Scientific Reports, 11, 3266.

+ Open protocol

+ Expand

Generating UZGENT_A3 and UZGENT_G5 Mutants

Check if the same lab product or an alternative is used in the 5 most similar protocols

Plasmids encoding heavy chains of UZGENT_A3 and UZ_GENT_G5 were subjected to PCR reactions with primers containing mismatches resulting in AAC to CAG codon change.

Primer name	Polarity	Primer sequence
UZGENT_A3 HC-N59Q	Sense	GATCAACCCTAACAGTGGCGGAACACAGTACACACAGAAGTTTAAG
UZGENT_A3 HC-N59Q	Antisense	CTTAAACTTCTGTGTGTACTGTGTTCCGCCACTGTTAGGGTTGATC
UZGENT_G5 HC-N59Q	Sense	CTATCAGTGGTGCCACACAGTATACACAGAAGTTTCAGGG
UZGENT_G5 HC-N59Q	Antisense	CCCTGAAACTTCTGTGTATACTGTGTGGCACCACTGATAG

Following thermal cycling with PfuTurbo DNA polymerase, Dpn1 endonuclease was used to digest the template DNA. PCR products were then transformed into competent DH5a cells (New England Biolabs). Preparation of pure plasmid DNA was performed with the NucleoSpin 96 Plasmid kit (Machery-Nagel). Presence of desired mutations was confirmed by Sanger sequencing. UZGENT_A3, UZ_GENT_G5 and their N59Q mutants were then produced in HEK293Ts as described above and purified on Protein G spin columns according to the manufacturer guidelines (Thermo Scientific). Eluates were subjected to desalting and concentration using Amicon Ultra columns with 50 kDa filters (Merck Millipore).

Acar D.D., Witkowski W., Wejda M., Wei R., Desmet T., Schepens B., De Cae S., Sedeyn K., Eeckhaut H., Fijalkowska D., Roose K., Vanmarcke S., Poupon A., Jochmans D., Zhang X., Abdelnabi R., Foo C.S., Weynand B., Reiter D., Callewaert N., Remaut H., Neyts J., Saelens X., Gerlo S, & Vandekerckhove L. (2024). Integrating artificial intelligence-based epitope prediction in a SARS-CoV-2 antibody discovery pipeline: caution is warranted. eBioMedicine, 100, 104960.

+ Open protocol

+ Expand

Gateway Cloning of Genomic ORFs

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human hsPRS-v2 and hsRRS-v2 ORFs are available in pDONR221 or pDONR223 vectors, which make them compatible with the Gateway-cloning technology. Each ORF was introduced into the different assay-specific expression vectors used in this study via an LR clonase-mediated Gateway reaction (Life Technologies). LR reaction products were subsequently transformed into DH5α competent bacterial cells and grown for 24 h in ampicillin-containing TFB liquid medium. Plasmid DNA was extracted using a NucleoSpin 96 Plasmid kit from Macherey-Nagel. After PCR-amplification using plasmid-specific primers, the size of each DNA amplicon was examined by agarose gel electrophoresis. For each batch of ready-to-go destination vectors, DNA sequencing was performed on a subset of the cloned samples to check the quality of cloning before running the PPI assays.

Choi S.G., Olivet J., Cassonnet P., Vidalain P.O., Luck K., Lambourne L., Spirohn K., Lemmens I., Dos Santos M., Demeret C., Jones L., Rangarajan S., Bian W., Coutant E.P., Janin Y.L., van der Werf S., Trepte P., Wanker E.E., De Las Rivas J., Tavernier J., Twizere J.C., Hao T., Hill D.E., Vidal M., Calderwood M.A, & Jacob Y. (2019). Maximizing binary interactome mapping with a minimal number of assays. Nature Communications, 10, 3907.

+ Open protocol

+ Expand

LR Cloning and Bacterial Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

LR reactions were performed in 96 well format using 1 µl of pFLIP Destination vector (∼25 ng/µl), 1 µl of PAS Entry clone (∼25 ng/µl) and 0.5 µl LR clonase II (Invitrogen). Samples were incubated 1–18 hr at 25°C and then added to 50 µl of chemically competent TOP10 E. coli cells (Invitrogen). Bacterial transformation was performed according to manufacturer instructions (Invitrogen) except that after heat shock and dilution in SOC medium, 50 µl of the cell solution was again diluted in 800 µl Luria–Bertani (LB) medium containing 100 µg/ml carbenicillin (Sigma, St. Louis, MO) and cultured overnight. These cultures were then diluted again (20 µl in 2000 µl) in LB medium with carbenicillin and cultured overnight. Expression plasmids were isolated in 96-well format using the NucleoSpin 96 Plasmid kit according to manufacturer’s instructions (Machery-Nagel, Düren, Germany).

Jones A.M., Danielson J.Å., ManojKumar S.N., Lanquar V., Grossmann G, & Frommer W.B. (2014). Abscisic acid dynamics in roots detected with genetically encoded FRET sensors. eLife, 3, e01741.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!