Turbofect sirna transfection reagent

Small-interfering RNA (siRNA) for cathepsin B was designed and synthesized by Guangzhou RiboBio (RiboBioInc, China). The sequence of each gene and their scrambled form are shown asfollows:1) cathepsin B, sense and antisense siRNAs were 5’- GGCCCCCTGCATCTATCG -3’ and 5’- AGGTCTCCCGCTGTTCCACTG -3’, respectively; 2) the scrambled control, sense and antisense siRNAs were 5’ -UGGUUUACAUGUCGACUAA(dTdT)-3’and 5’-UUAGUCGACAUGUAAACCA(dTdT)-3’, respectively. Twenty-four hours prior to transfection, SW480cells were plated on a 6-well plate (Nest, Biotech, China) at 30–50% confluence. Cells were then transfected using TurboFectTM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) following the manufacturer's protocol. Cells were collected after 48-72 h. The mRNA and protein levels of the SW480cells were estimated by RT-PCR and Western blotting. After incubating for 2days at 37°C in a humidified atmosphere of 5% CO₂, the cells were exposed to heat stress.

The pEGFP-C3-Bax constructs were created using a Quick Change site directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer’s instructions. pcDNA3-p53NLS was generated by subcloning using pCMV BamNeop53NLS58 (link). To establish Bax-stable transfected cells or p53NLS-stable transfected cells, HUVEC and H1299 cells were transfected with pEGFP-C3-Bax or p53NLS plasmid. Positive clones overexpressing Bax or p53NLS were selected with 1 mg/ml G418 as described previously59 (link). Small-interfering RNA (siRNA) for Bax was designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China), which was transfected into cells using TurboFect^TM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer’s protocol. Cells were collected after 48–72 h for further experiments. The mRNA and protein levels of Bax were estimated by RT-PCR and western blot, respectively.

miR-203 inhibitor and si-ZEB2s were purchased from RiboBio Inc, Guangzhou, China. ZEB2 cDNA was chemically synthesized and then constructed into adenovirus vector (Shanghai Genechem Co., Ltd., China). Twenty-four hours before transfection, NPC cells were plated onto a 6-well plate (Nest, Biotech, China) at 30–50% confluence. They were then transfected into cells using TurboFectTM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer's protocol. Cells were collected after 48-72 hrs for further experiments.

Small-interfering RNA (siRNA) for ENO1 was designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China). p85α plasmid was purchased in Biosense technologies, guangzhou, China. Three siRNAs targeting on ENO1 gene were designed and synthesized, the most effective siRNA (siENO1) identified by Real Time-PCR was applied for the further experiments. The sequence of siENO1 is: sense: 5′-GCAUUGGAGCAGAGGUUUAdTdT-3′-203′-anti-sense: 3′-dTdTCGUAACCUCGUCUCCAAAU-5′-. Twenty-four hours prior to transfection, EC cells Ishikawa, HEC-1B and HEEC were plated onto a 6-well plate or a 96-well plate (Nest Biotech, China) at 30–50% confluence. Constructs were then transfected into cells using TurboFect TM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer's protocol. Cells were collected after 48–72 h for further experiments. PI3K inhibitor Ly294002 was bought from Sigma. 1.5 × 10⁴ cells were seeded in 6-well plates. After culturing for 24 h, cells were treated with or without Ly294002 at the 10 μM concentration, cells were collected after 48 h for further experiments.

Small-interfering RNA (siRNA) for ENO1 was designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China). Three siRNAs targeting on ENO1 gene were designed and synthesised, the most effective siRNA (siENOA) identified by Real Time-PCR was applied for the further experiments. The sequence of siENO1 is: sense: 5′-GCAUUGGAGCAGAGGUUUAdTdT-3′; anti-sense: 3′-dTdTCGUAACCUCGUCUCCAAAU-5′. The sequence of si-negative control (si-Ctr) was also designed by RiboBio (RiboBio Inc., China). Twenty-four hours prior to transfection, glioma cells U87 and U251 were plated onto a 6-well plate or a 96-well plate (Nest Biotech, China) at 30–50% confluence. They were then transfected into cells using TurboFect TM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer’s protocol. Cells were collected after 48–72 hr for further experiments.

The siRNAs for Slug (5′-GCAUUUGCAGACAGGUCAAdTdT-3′, 5′-UUGACCUGUCUGCAAAUGCdTdT-3′), Hey1 (5′-CAGUUUGUCUGAGCUGAGATT-3′, 5′-UCUCAGCUCAGACAAACUGTT-3′), Hes1 (5′-AGGCUGGAGAGGCGGCUAATT-3′, 5′-UUAGCCGCCUCUCCAGCCUTT-3′), and negative control (NC: 5′-UUCUCCGAACGUGUCACGUTT-3′, 5′-ACGUGACACGUUCGGAGAATT-3′) were synthesized by GenePharm (Shanghai, China). Cells (5 × 10⁴ per well) were seeded in six-well plates 24 h prior to transfection and transfected with 80 pM siRNA using TurboFectTM siRNA Transfection Reagent (Fermentas, Beijing, China), according to the manufacturer’s protocol.

siRNA for ENO1 was designed and synthesized by Guangzhou RiboBio (RiboBio Inc, China). The sequence of siENO1 is sense: 5′-GCAUUGGAGCAGAGGUUUAdTdT-3′ and anti-sense: 3′-dTdTCGUAACCUCGUCUCCAAAU-5′. The sequence of si-negative control (si-Ctr) was also designed by RiboBio (RiboBio Inc, China). Twenty-four hours prior to transfection, NSCLC cells A549 and SPCA-1 were plated onto a 6-well plate or a 96-well plate (Nest Biotech, China) at 30%–50% confluence. They were then transfected into cells using TurboFect TM siRNA Transfection Reagent (Fermentas, Vilnius, Lithuania) according to the manufacturer’s protocol. Cells were collected after 48–72 h for further experiments.