Sybr green pcr master mix

Manufactured by DBI Bioscience

Sourced in China

SYBR Green PCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) applications. It contains SYBR Green I dye, which binds to double-stranded DNA and emits fluorescence upon binding, enabling real-time detection and quantification of PCR products.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (2 mentions) Cdna synthesis kit, by DBI Bioscience (1 mentions) Reverse transcription kit, by DBI Bioscience (1 mentions) Transzol reagent, by Transgene (1 mentions) Dnase 1, by Roche (1 mentions) Spss statistics 17, by IBM (1 mentions) Stratagene rt pcr system, by Thermo Fisher Scientific (1 mentions) Steponeplus system, by Thermo Fisher Scientific (1 mentions) Superscript 3, by Thermo Fisher Scientific (1 mentions) Trizol, by Thermo Fisher Scientific (1 mentions) Abi prism 7900 sequence detection system, by Thermo Fisher Scientific (1 mentions)

8 protocols using sybr green pcr master mix

Quantitative Real-Time PCR for EZH2-Interacting RNAs

Check if the same lab product or an alternative is used in the 5 most similar protocols

RIP was followed by quantitative real-time PCR using an ABI 7900 Real Time PCR Instrument, using the SYBR green PCR Master Mix (DBI bioscience). U1 was used as a control RNA for normalization. The primer sequences are shown in Supplementary Table 5.
To test the authenticity of EZH2-interacting RNAs, RIP assay under more stringent condition was performed [30 (link)] and RIP enriched RNAs were subjected to RT-qPCR. The primer sequences are shown in Supplementary Table 5.

Qi Y., Ooi H.S., Wu J., Chen J., Zhang X., Tan S., Yu Q., Li Y.Y., Kang Y., Li H., Xiong Z., Zhu T., Liu B., Shao Z, & Zhao X. (2016). MALAT1 long ncRNA promotes gastric cancer metastasis by suppressing PCDH10. Oncotarget, 7(11), 12693-12703.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Cardiac Fibrosis

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated by Trizol, and then was reverse transcribed using cDNA synthesis kit (DBI Bioscience, Ludwigshafen, Germany). All primers were designed by Premier 5.0 software or reported in previous literature [7 (link)], and were synthesized by Invitrogen. The primer sequences are as followings: rat TNF-α (sense: TGTTCATCCGTTCTCTACC; antisense: CCACTACTTCAGCGTCTC), rat IL-6 (sense: CGGAGAGGAGACTTCACA; antisense: GCATCATCGCTGTTCATAC), rat collagen type I (Col1a1) (sense: ATCCTGCCGATGTCGCTAT; antisense: CCACAAGCGTGCTGTAGGT), rat collagen type III (Col3a1) (sense: CTGGTCCTGTTGGTCCATCT; antisense: ACCTTTGTCACCTCGTGGAC), rat angiotensin-converting enzyme (ACE) (sense: TTGGCTCTGTCTGTGTCT; antisense: CTCCTTGGTGATGCTTCC), rat Ang (sense: CTGGAGCTAAAGGACACACAGA; antisense: CAGGGTCTTCTCATCCACGG), rat Renin (sense: CACCTTCATCCGCAAGTT; antisense: GCAGAGCCAGACAGAATG), rat AT1R (sense: GGCAGGCACAGTTACATAT; antisense: CAAGGCGAGATTGAGAAGA). Each real-time PCR were carried out in a total volume of 20 μl with SYBR Green PCR Master Mix (DBI Bioscience) with the reaction condition: 95°C 2min, 40 cycles at 95°C 15S, 60°C 15S, 68°C 10S, 72°C 20S. Relative mRNA expression levels were firstly normalized to β-actin by using the ΔΔCt method and then normalized the value for each sample by divided it by the value of one sample from that of the Con+Ve group.

Guo W., Guan X., Pan X., Sun X., Wang F., Ji Y., Huang P., Deng Y., Zhang Q., Han Q., Yi P., Namaka M., Liu Y., Deng Y, & Li X. (2016). Post-Natal Inhibition of NF-κB Activation Prevents Renal Damage Caused by Prenatal LPS Exposure. PLoS ONE, 11(4), e0153434.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using TRIzol (DBI Bioscience, Shanghai, China). cDNA was obtained using a reverse transcription kit (DBI Bioscience, Shanghai, China) and amplified using SYBR Green PCR Master Mix (DBI Bioscience, Shanghai, China) according to the manufacturer’s instructions. β-actin was used to normalize gene expression, and the relative gene expression values were calculated using the 2^–∆∆Ct method^{20 (link)}. Primer sequences were retrieved from PrimerBank 40 (Supplementary Table 2), and primer specificity was further validated using the National Center for Biotechnology Information Primer-BLAST tool.

Chang W., Cui J., Li Y., Zang K., Zhang X., Zhang Z., Jiang Y., Ma Q., Qu S., Liu F, & Xue J. (2023). Transcriptomic analysis of the cerebral hippocampal tissue in spontaneously hypertensive rats exposed to acute hypobaric hypoxia: associations with inflammation and energy metabolism. Scientific Reports, 13, 3681.

+ Open protocol

+ Expand

Total RNA Isolation and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from roots tissue or protoplasts using TransZol reagent (TransGen Biotech); genomic DNA contamination was eliminated with DNase I (Roche). M-MLV reverse transcriptase (Thermo Scientific) was used for first-strand cDNA synthesis. Real-time PCR was conducted in technical triplicates using SYBR Green PCR master mix (DBI Bioscience). GhACTIN14 was used as the reference gene. Three to four biological replicates were performed; the results were analyzed with SPSS statistics 17.0 (IBM).

Zhang K., Liu S., Fu Y., Wang Z., Yang X., Li W., Zhang C., Zhang D, & Li J. (2023). Establishment of an efficient cotton root protoplast isolation protocol suitable for single-cell RNA sequencing and transient gene expression analysis. Plant Methods, 19, 5.

+ Open protocol

+ Expand

Protein and mRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cellular and nuclear proteins were extracted from cells 68 (link). Protein expression of ABCA1, ABCG1, KLF4, VCAM-1, ICAM-1, PECAM-1, CD36, LOX-1, αSMA, GAPDH, CD68, SRBI, Lamin A/C, and SRA were determined by Western blot. Total RNA was extracted from cells or aorta followed by determination of mRNA expression by quantitative real-time PCR (q-RT-PCR) with a reverse transcription kit (Vazyme bioteck co., ltd), a SYBR green PCR master mix (DBI, Bioscience), and the primers with sequences listed in Table 2. Expression of IL-1β, TNF-α, IL-6, Arg1 and iNOS mRNA was normalized by GAPDH mRNA in the corresponding samples.

Ma C., Xia R., Yang S., Liu L., Zhang J., Feng K., Shang Y., Qu J., Li L., Chen N., Xu S., Zhang W., Mao J., Han J., Chen Y., Yang X., Duan Y, & Fan G. (2020). Formononetin attenuates atherosclerosis via regulating interaction between KLF4 and SRA in apoE-/- mice. Theranostics, 10(3), 1090-1106.

+ Open protocol

+ Expand

Quantifying Hippocampal Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the hippocampal tissues of rats by using TRIzol reagent (Invitrogen, CA, USA), and cDNA was synthesized using a qRT-PCR kit (Bestar; DBI Bioscience). qRT-PCR was performed in a Stratagene RT-PCR system (Applied Biosystems, USA) by using SYBR^® Green PCR Master Mix (DBI Bioscience). The thermal cycling conditions were as follows: 95 °C for 2 min, followed by 40 cycles of 94 °C for 20 s, 58 °C for 20 s, and 72 °C for 40 s. The relative expression of each target gene was quantified using the 2^−ΔΔCt method. GAPDH was used to normalize circLrp1b and Dram2 mRNA. U6 served as an endogenous control for miR-27a-3p. The primer sequences are listed in Table 1.

Li H., Lu C., Yao W., Xu L., Zhou J, & Zheng B. (2020). Dexmedetomidine inhibits inflammatory response and autophagy through the circLrp1b/miR-27a-3p/Dram2 pathway in a rat model of traumatic brain injury. Aging (Albany NY), 12(21), 21687-21705.

+ Open protocol

+ Expand

Quantifying Apoptosis-Related Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The quantification of mRNA levels of apoptosis-related genes was evaluated using RT-qPCR. Total RNA was extracted using Trizol (Life Technologies Corp.) and subjected to reverse transcription with random primers using SuperScript III (Life Technologies Corp.) to obtain cDNAs. RT-qPCR was performed using a SYBR Green PCR Master Mix (DBI Bioscience, Shanghai, China) according to the manufacturer’s protocol. The primer sequences were used for real-time PCR (S5 Table). Threshold cycle (Ct) values were automatically calculated by the Applied Biosystems StepOnePlus system (Applied Biosystems Inc., Foster City, CA, USA). The PCR conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min. The intensity of each gene was normalized by GAPDH expression. According to the ΔΔCt method, differential expression was calculated as a ratio of the expression levels of target genes in PGL-treated and -untreated cells.

Kang Y., Li H., Wu J., Xu X., Sun X., Zhao X, & Xu N. (2016). Transcriptome Profiling Reveals the Antitumor Mechanism of Polysaccharide from Marine Algae Gracilariopsis lemaneiformis. PLoS ONE, 11(6), e0158279.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells and frozen samples by using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and then reverse transcribed into cDNA. Real-time polymerase chain reaction (PCR) was performed using SYBR Green PCR Master Mix (DBI^® Bioscience, Ludwig-shafen, Germany) and ABI PRISM 7900 Sequence Detection System (Thermo Fisher Scientific). Results were normalized to β-actin for mRNA measurement. All the primer sequences used in this study were listed as follows: PD-L1 (forward: TGGCATTTGCTGAACGCATTT, reverse: TGCAGCCAGGTCTAATTGTTTT); CD8A (forward: ATGGCCTTACCAGTGACCG, reverse: AGGTTCCAGGTCCGATCCAG); interferon (IFN)-γ (forward: TCGGTAACTGACTTGAATGTCCA, reverse: TCGCTTCCCTGTTTTAGCTGC); β-actin (forward: CATGTACGTTGCTATCCAGGC, reverse: CTCCTTAATGTCACGCACGAT).

Zhu Y., Wang X.Y., Zhang Y., Xu D., Dong J., Zhang Z., Yi C.H., Jia H.L, & Yang X. (2018). Programmed death ligand 1 expression in human intrahepatic cholangiocarcinoma and its association with prognosis and CD8+ T-cell immune responses. Cancer Management and Research, 10, 4113-4123.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!