Control morpholino

Tg(fli1:eGFP) embryos were collected immediately after spawning and injected at the 1–2 cell stage with 3–5 nL of 100 µM AhR2 or Control morpholino, diluted in Danieau buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO₄, 0.6 mM Ca(NO₃)₂, 5 mM HEPES, pH 7.6). Control morpholino with the sequence 5′-GACGTTGTCATTTATTTGATTTTCG-3′ was purchased from GeneTools, LLC., Philomath, OR, USA, and is reported to have no detectable effects on zebrafish development (GeneTools). AhR2 morpholino with the sequence 5′-TGTACCGATACCCGCCGACATGGTT-3′ was a generous gift of Dr. Teraoka, and has been demonstrated to effectively block expression of the aryl hydrocarbon receptor in zebrafish [27 (link),28 (link)]. Morpholino injected embryos were allowed to develop for 24 h at 28 °C in ERM, before being manually dechorionated and transferred to dishes with 10 µM PhN or vehicle controls. Morphant embryos were exposed to these treatments for 24 h before being examined for morphological defects and fixed in 4% formaldehyde and imaged by confocal microscopy.

The following plasmids and Morpholinos have been described previously: pcDNA-flag-arrb2[13] (link), pCS2+ fzd7, pCS2+ rhoA V12, pCS2+ rac1 V14[18] (link), pCS2+ cdc42[19] (link); Arrb2 Morpholino 1 (Arrb2 MO1, [13] (link)), Fzd7 Morpholino [3] (link), Dvl2 MO [7] (link), Dvl1 MO, Dvl3 MO [20] (link).
The Arrb2 Morpholino 2 (Arrb2 MO2 5′-CGCACGGTTCCAAACGCACAGTAGG- 3′) and a Control Morpholino (Control MO) were purchased from Gene Tools LLC (OR, USA). The additional 5′UTR sequence of the arrb2 mRNA has been submitted to Genebank (accession number KF831094).
The expression plasmids pCS2+ pkcα-gfp, pCS2+ dn pkcα, pCS2+ camkII K42M, pCS2+ camkII T286D were generously provided by Michael Kühl (University Ulm, Germany); pcDNA HA-gβ1 (HA-gnb1), pcDNA HA-gγ2 (HA-gng2) and pRK5 β-ARKct were provided by G. Schulte (Karolinska Institute, Stockholm, Sweden). The fragment encoding β-ARKct was subcloned into pCS2+. The open reading frames encoding Xenopus Dvl1, Dvl2 and Dvl3 were amplified by PCR and cloned into pCS2+ myc (R. Rupp, LMU Munich, Germany).

For tnfr1 (also known as tnfrsf1a, NM_213190) loss-of-function experiments, we used morpholino antisense oligonucleotides (Gene Tools, Philomath, OR, USA) – that specifically hybridized with Exon 5-Intron 5 splicing site (MO zTNFRsplD5 referred here as tnfr1 MO): 5′-GGAAGCATGAGGAACTTACAGTTCT-3′. For tnfa loss-of-function experiments, tnfa MO (MO tnfaD1) that specifically hybridized with Exon 1- Intron 1 splicing site was used (5′-GGGCAGGATTTTCACCTTATGGAGC-3′). As a control, Control morpholino from Gene Tools was used (ctrl MO, 5′-AATCACAAGCAGTGCAAGCATGATG-3′).
7 ng of tnfr1, tnfa or Control morpholinos were injected in one-cell stage embryos with a Femto.Jet from Eppendorf. No side effect was observed. Efficiency was tested by RT-PCR, using primers from both sides of the morpholino target: zTNFR1.5 (5′-CAGGAATGCAGTGCAGAAAA-3′) and zTNFR1.30 (5′-AAAAAGACTGGGGGAATGCT-3′).

To knock down translation of P47^phox, the antisense oligonucleotide morpholino (5’ CGGCGAGATGAAGTGTGTGAGCGAG 3’), overlapping the AUG start codon was used (Phan et al., 2018). 3 nL of 0.25 mM MOp47^phox were injected at one-cell stage. To knock down SFK Lyn, the splicing morpholino MOLyn (5’ GAGTCTGTATTTCAGTACCATTAGC 3’) targeting the Exon9-Intron9/10 site was used (Yoo et al., 2011). 2 nL of 0.5 mM morpholino were injected at one-cell stage. To knock down SFK Yrk, the splicing morpholino MOyrk (5’ CAATAACTGCACAAACGCACCTTTA 3’) targeting Exon6-Intron6/7 site was used (Tauzin et al., 2014). 2 nL of 0.25 mM or 0.5 mM morpholino were injected at one-cell stage. For all MO injections, Control morpholino (standard control from Gene Tools, 5’ CCTCTTACCTCAGTTACAATTTATA 3’) was injected in the same corresponding amount at one cell-stage. The efficiency of yrk and lyn morpholinos was validated by RT-PCR (see following sub-section) and sequencing of the PCR products. For MOp47^phox the efficiency was validated by checking the NADPH oxidase activity with DHE staining (see larva staining sub-section).

Morpholino oligonucleotides (GENE-TOOLS, OR, USA) were diluted with ultra-pure (miliQ) water and phenol red (SIGMA) and 2ng of each were injected into one-cell stage embryos. Morpholino sequences: tnnt2 morpholino 5′ CATGTTTGCTCTGACTTGACACGCA 3′ as published [35 (link)], klf2b morpholino 5′ AGTGTCAAATACTTACATCCTCCCA 3′, control morpholino 5′ CCTCTTACCTCAGTTACAATTTATA 3′ (GENE TOOLS stock control).