Genomic DNA was extracted by using NucleoSpin Tissue XS (Macherey-Nagel, Bethlehem, PA) and bisulfite converted by using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA). Foxp3 CNS2 region was amplified by PCR containing 5 ng of bisulfite-converted genomic DNA, HotStar Taq PCR buffer (QIAGEN, Valencia, CA), 0.5 U HotStar Taq DNA polymerase, 2.5 mM MgCl2 and 0.38 μM each of forward and reverse primers (Ohkura et al., 2012 (link); Yang et al., 2016 (link)) in a final volume of 25 μl (95°C for 10 min; 40 cycles: 95°C for 30 s, 58°C for 1 min, 72°C for 1 min; 72°C for 5 min). The PCR product was analyzed by gel electrophoresis and TA cloned using TOPO TA Cloning Kit (Invitrogen) and One Shot TOP10 Chemically Competent E. coli. Colonies were picked and submitted for direct colony sequencing. Sequencing results were analyzed on Bisulfite Sequencing DNA Methylation Analysis website (Rohde et al., 2010 (link)).
Hotstar taq pcr buffer
Manufactured by Qiagen
Sourced in United States
The HotStar Taq PCR buffer is a reagent used in the polymerase chain reaction (PCR) process. It is designed to facilitate the amplification of DNA sequences by providing the necessary components for the PCR reaction.
Automatically generated - may contain errors
Lab products found in correlation
Hotstartaq dna polymerase, by Qiagen (7 mentions)
Ez dna methylation kit, by Zymo Research (3 mentions)
Pyromark gold q96 reagent, by Qiagen (3 mentions)
Pyromark buffers, by Qiagen (3 mentions)
Streptavidin sepharose, by GE Healthcare (3 mentions)
Psq 96ma, by Qiagen (2 mentions)
Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)
Nucleospin tissue xs, by Macherey-Nagel (1 mentions)
Qiaamp dna kit, by Qiagen (1 mentions)
Swift maxpro, by Esco Lifesciences (1 mentions)
T7 primer, by Eurogentec (1 mentions)
Nucleospin tissue xs kit, by Macherey-Nagel (1 mentions)
Nanodrop 1000 spectrophotometer, by Avantor (1 mentions)
Pyromark q96 id, by Qiagen (1 mentions)
Nucleospin tissue kit, by Macherey-Nagel (1 mentions)
Massarray system, by Agena (1 mentions)
Iplex reagents, by Agena (1 mentions)
7 protocols using hotstar taq pcr buffer
1
Foxp3 Regulatory Region DNA Methylation Analysis
2
Quantifying DNA Methylation in T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from ex vivo isolated or in vitro cultivated T cells, as well as other ex vivo isolated immune cell subsets was bisulfite converted by using the EZ DNA Methylation Kit (Zymo Research). Validated candidate regions from MS-HRM analysis were amplified by PCR containing 10 ng of bisulfite-converted genomic DNA, HotStar Taq PCR buffer (Qiagen), 1 U HotStar Taq DNA polymerase, 2.5 mM MgCl2 and 0.38 μM each of forward and reverse primers (Supplementary Table S1) in a final volume of 50 μl (95°C for 15 min; 50 cycles: 95°C for 30 s, 57°C for 1 min, 72°C for 1 min; 72°C for 7 min). The PCR product was analyzed by gel electrophoresis. 20–40 μl of the PCR product, Pyromark Gold Q96 reagents (Qiagen), Pyromark buffers (Qiagen), Streptavidin Sepharose (GE Healthcare) and sequencing primers (Supplementary Table S1) were used for pyrosequencing on a PSQ96MA (Qiagen) according to the manufacturer's protocol. Significance of methylation rate differences between compared subsets was calculated using Prism (GraphPad Software) and a two-way ANOVA with Bonferroni's multiple comparisons test. Locations of analyzed CpG motifs in mouse genome GRC38m are listed in Supplementary Table S2.
3
VNTR Genotyping of SLC6A3 Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from plasma samples using QIAamp DNA kit (QIAGEN, Hilden, Germany). VNTR genotyping was achieved by amplifying part of the 3′ untranslated region with the polymerase chain reaction on a Perkin Elmer 9700 (PerkinElmer, Foster City, CA, USA) thermal cycler using 50 ng of genomic DNA, 0.15 μM of forward (5′-TGTGGTGTAGGGAACGGCCTGAG-3′) and reverse primer (5′-CTTCCTGGAGGTCACGGCTCAAGG-3′), 0.2 mM dNTP and 1.0 U HotStarTaq DNA polymerase (QIAGEN) in a buffered (QIAGEN HotStarTaq PCR Buffer) solution. The cycling conditions for amplification consisted of an initial denaturation period of 15 min at 95 °C, followed by 45 cycles of 25 s at 95 °C and 40 s at 72 °C, followed by 10 min at 72 °C. Analysis on a 3% agarose gel yielded distinct bands for the 9- and 10-repeat alleles. The two SLC6A3 VNTR genotype groups did not differ with respect to age.
4
Singleplex PCR Reaction Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The singleplex PCR reaction (Table 1 : PCR) was performed in a final volume of 10 μL which included 1X HotStarTaq PCR buffer (Qiagen), 125 nM T7 primer (Eurogentec), 500 nM 5′-biotin-T3 or 5′-Alexa 532-T3 primer (Eurogentec), 200 μM of each dNTP (Thermo Scientific), 0.25 or 0.5 units HotStarTaq DNA polymerase (Qiagen), and 3 or 5 μL of ligase product. The following protocol was run in a thermal cycler (Swift MaxPro, Esco): 15 min at 95°C, 35 to 40 cycles of 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C, 5 min at 72°C.
5
Methylation Analysis of Murine Tregs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all methylation analyses, cells from male mice were used. Genomic DNA was isolated from purified cells with the NucleoSpin Tissue XS kit (Macherey-Nagel) following the manufacturer's recommendations. Purified DNA was quantified by measuring the absorption of light at 260 nm wavelength with a Nanodrop 1000 spectrophotometer (Peqlab). For analysis of TSDR, the TSDR was amplified by PCR containing 10 ng of bisulfite-converted genomic DNA, HotStar Taq PCR buffer (Qiagen), 1 U HotStar Taq DNA polymerase, 2.5 mM MgCl2 and 0.38 μM each of forward and reverse primers in a final volume of 50 μl (Cycle: 95°C for 15 min; 50x 95°C for 30 sec, 57°C for 1 min, 72°C for 1 min; 72°C for 7 min). The PCR product was analyzed by gel electrophoresis. 20-40 μl of the PCR product, Pyromark Gold Q96 reagents (Qiagen), Pyromark buffers (Qiagen), Streptavidin Sepharose (GE Healthcare) and sequencing primers (Supplementary Table S5 ) were used for pyrosequencing on a PSQ96MA (Qiagen) according to the manufacturer's protocol. For Treg-specific epigenetic signature genes, the analysis was carried out using bisulfite sequencing as described previously [13 (link)].
6
Methylation Analysis of Murine TSDR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from cells of interest was obtained using the NucleoSpin Tissue kit (Macherey-Nagel). Genomic DNA was subjected to bisulfite conversion using the EZ DNA Methylation Kit (Zymo Research). The murine TSDR was amplified by PCR containing 100 ng of bisulfite-converted genomic DNA, HotStar Taq PCR buffer (Qiagen), 1 U HotStar Taq DNA polymerase, 2.5 mM MgCl2 and 0.38 µM each of TSDR-for (AAGGGGGTTTTAATATTTATGAGG ) and TSDR-rev (CCTAAACTTAACCAAATTTTTCTACCA ) primer in a final volume of 25 µl (Cycle: 95°C for 15 min; 45×95°C for 30 sec, 57°C for 1 min, 72°C for 1 min; 72°C for 7 min). The PCR product was analyzed by gel electrophoresis. The pyrosequencing procedure was performed on a Pyromark Q96 ID (Qiagen) according to the manufacturer’s protocol, including 40 µl of the PCR product, Pyromark Gold Q96 reagents (Qiagen), Pyromark buffers (Qiagen), Streptavidin Sepharose (GE Healthcare) and the sequencing primers TSDR1 (AACCAAATTTTTCTACCATTA ), TSDR2 (AAAACAAATAATCTACCCC ) or TSDR3 (AATAAACCCAAATAAAATAATATAAAT ). The methylation rate was determined by the Pyromark Q96 software. A rate was excluded if the quality criteria (Pyromark Q96 standard settings) failed for that CpG motif. The methylation rate was translated into a color code as previously described [9] (link).
7
MassARRAY SNP Genotyping Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
SNP genotyping was done at Inqaba Biotechnical Industries (Pty) Ltd Pretoria, South Africa on the MassARRAY system from Agena Biosciences using the iPLEX reagents which included the iPLEX PCR, SAP, and iPLEX Extend following the iPLEX Gold Application Guide from Agena Biosciences (http://www.sequenom.com/Files/Genetic-Analysis-G raphics/iPLEXApplication/iPLEX-Gold-Application-G uide-v2r1) [37] [38] [39] . The procedure of iPLEX PCR is the same as the normal PCR. Briefly, 10 ng genomic DNA was amplified in a 5µl reaction containing 1 x HotStar Taq PCR buffer (Qiagen), 1.625 mM MgCl 2 , 0.5 mM each dNTP, 0.1µM each PCR primer, and 0.5 U Hot Star Taq DNA polymerase (Qiagen). The reaction was incubated at 94 o C for 4 min followed by 45 cycles of 94 o C for 20 s, 56 o C for 30 s, 72 o C for 1 min, and then followed by 3 min at 72 o C. After iPLEX, excess dNTPs were removed from the reaction by adding 2 µl shrimp alkaline phosphatase (SAP) enzyme solution (1.53 µl water (HPLC grade), 0.17 µl SAP buffer (10x), 0.30 µl SAP enzyme (1.7 U/ µl)) into each sample well and mixed, and then incubated at 37 o C for 20 minutes followed by 5 minutes at 85 o C to deactivate the enzyme called SAP procedure in iPLEX.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!