Fast mutagenesis kit v2

Manufactured by Vazyme

Sourced in China

The Fast Mutagenesis Kit V2 is a laboratory tool designed for the rapid and efficient introduction of site-specific mutations into DNA sequences. The kit provides a streamlined protocol and reagents necessary for performing mutagenesis experiments.

Automatically generated - may contain errors

Lab products found in correlation

Dual luciferase reporter assay system, by Promega (2 mentions) Dual luciferase assay kit, by Promega (2 mentions) One step cloning kit, by Vazyme (2 mentions) Pcdna3.1 flag, by Thermo Fisher Scientific (2 mentions) Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions) Enspire multilabel reader, by PerkinElmer (1 mentions) Nucleospin gel and pcr clean up kit, by Macherey-Nagel (1 mentions) Mmessage mmachine kit, by Thermo Fisher Scientific (1 mentions) Pegfp n3, by Thermo Fisher Scientific (1 mentions) Peroxidase conjugated affinipure goat anti rabbit igg, by Proteintech (1 mentions) Alexa fluor 488 phalloidin, by Thermo Fisher Scientific (1 mentions) Alexa fluor 647, by Thermo Fisher Scientific (1 mentions) Pitstop 2, by Merck Group (1 mentions) Hoechst 33342, by Merck Group (1 mentions) Anti β tubulin, by Abcam (1 mentions) Mimic nc, by GenePharma (1 mentions) Mir 27b 3p mimic, by GenePharma (1 mentions) Pcdna3.1 vector, by Promega (1 mentions) Sirnas, by GenePharma (1 mentions) Cycloheximide (chx), by Solarbio (1 mentions)

Spelling variants of this product

Mut Express II Fast Mutagenesis Kit V2 (159 citations) Mut Express MultiS Fast Mutagenesis Kit V2 (26 citations) Fast Mutagenesis Kit (19 citations) Mut Express® II Fast Mutagenesis Kit V2 System (3 citations)

29 protocols using fast mutagenesis kit v2

Transient Expression of PgMYB2 in Arabidopsis and Ginseng

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used the Dual-Luciferase^® Reporter Assay System (Promega, Madison, USA) to detect the transient expression of PgMYB2 in the protoplasts of A. thaliana. In the assay of the dual-luciferase reporter gene, the pGreenII 0800-DDSpro-LUC reporter and the pEGAD-MYC-PgMYB2 effector were co-transfected into Arabidopsis protoplasts using PEG-Ca. The knockout of MBSII was performed with the Fast Mutagenesis Kit V2 (Vazyme, Nanjing, China). The luminescent signals were detected by EnSpire^® Multilabel Reader (PerkinElmer, Waltham, USA).
In the experiment of transiently overexpressing PgMYB2 in ginseng leaves, we used the same EHA105 strain in the subcellular localization. The EHA105 cells were cultured in LB medium (containing 0.01 M MES and 40 μM acetosyringone) and grew overnight on a shaker at 250 rpm. The bacteria pellets were collected by centrifugation, resuspended to OD600 = 1.0 with a solution of 10 mM MgCl₂ and 0.2 mM acetylclogenone, and kept it standing more than 3 h. The EHA105 suspension was injected into the lower epidermis of ginseng leaves in the flourishing period (about 2 months) by a sterile syringe. The injected ginseng plants were grown at 25 °C for two days, then the infiltrated leaves were cut off for subsequent RNA extraction. Three sets of parallel replicates were set up in all experiments.

Liu T., Luo T., Guo X., Zou X., Zhou D., Afrin S., Li G., Zhang Y., Zhang R, & Luo Z. (2019). PgMYB2, a MeJA-Responsive Transcription Factor, Positively Regulates the Dammarenediol Synthase Gene Expression in Panax Ginseng. International Journal of Molecular Sciences, 20(9), 2219.

+ Open protocol

+ Expand

Murine TRPV1 Channel Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine TRPV1 (mTRPV1, a gift from Dr Michael X. Zhu, University of Texas Health Science Center at Houston) was used in this study, and all of the numbering of residues were based on this channel. In order to identify mTRPV1-expressing cells, enhanced yellow fluorescent protein was fused to the C terminus of the channel, which did not alter the function of TRPV1. Point mutations were made by Fast Mutagenesis Kit V2 (Vazyme Biotech) and confirmed by sequencing. Primers used to generate point mutations are summarized in Table S5.

Li Y., Chen X., Nie Y., Tian Y., Xiao X, & Yang F. (2021). Endocannabinoid activation of the TRPV1 ion channel is distinct from activation by capsaicin. The Journal of Biological Chemistry, 297(3), 101022.

+ Open protocol

+ Expand

GLIS1 Mutagenesis and Plasmid Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols

pcDNA3.1-flag-GLIS1 plasmids were obtained from WZ Biosciences Inc. (Jinan, China). Mutagenesis of GLIS1-1061G > A (pcDNA3.1-flag-mGLIS1) was performed using Fast Mutagenesis Kit V2 (Vazyme). GLIS1 mutant and wild-type plasmids were validated using Sanger sequencing.

Jin J.Y., Wu P.F., Luo F.M., Guo B.B., Zeng L., Fan L.L., Tang J.Y, & Xiang R. (2022). GLIS Family Zinc Finger 1 was First Linked With Preaxial Polydactyly I in Humans by Stepwise Genetic Analysis. Frontiers in Cell and Developmental Biology, 9, 781388.

+ Open protocol

+ Expand

Site-Directed Mutagenesis of PpILR1 Enzyme

Check if the same lab product or an alternative is used in the 5 most similar protocols

Site-directed mutagenesis was carried out using the recombinant plasmid pGEX-6P-1. The Cys137 residue, which is located in the PpILR1 enzyme binding pocket and is crucial for enzyme activity (Smolko et al., 2016 (link)), was changed to Ser137 using Fast Mutagenesis Kit V2 (Vazyme, Nanjing, China) according to the manufacturer's instructions. Briefly, point mutation of the PpILR1 gene was carried out using sequence-specific primers (forward: TGCACGCAAGCGGCCATGATAGCCATGTTGCA; reverse: CATGGCCGCTTGCGTGCATTTTACCGTCAATTT) synthesized by Shenggong (Shanghai, China). Homologous recombination was used to construct the plasmid that contained the mutation site. PYMOL software was used to construct the PpILR1 model.

Wang X., Meng J., Deng L., Wang Y., Liu H., Yao J.L., Nieuwenhuizen N.J., Wang Z, & Zeng W. (2021). Diverse Functions of IAA-Leucine Resistant PpILR1 Provide a Genic Basis for Auxin-Ethylene Crosstalk During Peach Fruit Ripening. Frontiers in Plant Science, 12, 655758.

+ Open protocol

+ Expand

Comparison of DNA Donor Templates for HDR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

We mainly set out to compare three donor DNA templates: long dsDNA (plasmid, short ssODN and long ssDNA. The long dsDNA donor templates for HDR were generated by PCR on wild type genomic DNA that was then cloned into pMD19-T and mutated precisely using Fast Mutagenesis Kit V2 (Vazyme) to generate a modified locus with two CRISPR target sites at both ends of the homologous arms, similar to that described previously [7 (link)]. This construct was also used to produce an RNA transcript using the T7 RiboMAX Express Large Scale RNA Production System and the RNA transcript was purified using mMESSAGE mMACHINE kit (Ambion). The long ssDNA donors were synthesized by reverse transcription from the RNA templates, this RNA template was then digested using RNase H and the remaining ssDNA was run on agarose gel and extracted from the gel slice using a NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). The short ssODN donors with homologous arms were synthesized by Sangon Biotech. The PAM sites or seed sequences in the HDR donors were altered to prevent re-cutting of the desired donor DNA.

Bai H., Liu L., An K., Lu X., Harrison M., Zhao Y., Yan R., Lu Z., Li S., Lin S., Liang F, & Qin W. (2020). CRISPR/Cas9-mediated precise genome modification by a long ssDNA template in zebrafish. BMC Genomics, 21, 67.

+ Open protocol

+ Expand

Regulatory SNPs Cloning and Luciferase Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

The upstream regulatory region containing the reference alleles of three SNPs (rs5011218, rs11191359, and rs4146428) was cloned into the PGL3-Basic vector using a One Step Cloning Kit (Vazyme, C112). This region is 1003 bp and contains the A alleles of rs5011218 and rs11191359 and G allele of rs4146428. The sequence and SNPs information are listed in table S8. The Fast Mutagenesis Kit V2 (Vazyme, C214) was used for SNP mutation. NPCs were co-transfected with 500 ng reconstructed vector, 10 ng pRL-TK, and 500 ng POU3F2 overexpression vectors (or empty vectors) in 24-well plates. After 48 h, the activities of firefly luciferase and renilla luciferase were measured using the dual-luciferase assay kit (Promega, E1910).

Ding C., Zhang C., Kopp R., Kuney L., Meng Q., Wang L., Xia Y., Jiang Y., Dai R., Min S., Yao W.D., Wong M.L., Ruan H., Liu C, & Chen C. (2020). Transcription factor POU3F2 regulates TRIM8 expression contributing to cellular functions implicated in schizophrenia. Molecular psychiatry, 26(7), 3444-3460.

+ Open protocol

+ Expand

Clathrin Light Chain Mutant Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hoechst 33342 and Pitstop 2 were purchased from Sigma-Aldrich. Pitstop 2 were dissolved in dimethyl sulfoxide (DMSO) according to the manufacturer’s instructions. The lipophilic dyes DiO and DiD were purchased from Biotium. The fluorescent dyes Alexa Fluor 647 and Alexa Fluor 488 phalloidin were purchased from Invitrogen. anti-β-tubulin was purchased from Abcam (USA). peroxidase-conjugated affinipure goat anti-rabbit IgG were purchased from proteintech (USA).
Using the primers listed in Table 1, the full-length CLCs were constructed in vectors including pcDNA3.1-flag, pEGFP-N3, and pmDsRed-C1 (Invitrogen). Site-directed mutants, including EaCLCa-W119R and EaCLCb-W122R, were all subcloned into the pEGFP-N3, pmDsRed-C1 and pcDNA3.1-flag vectors using specific primers (Table 1) and the Fast Mutagenesis Kit V2 (Vazyme). Tryptophan (W)119 of CLCa and W122 of CLCb were both replaced with arginine(R). In addition, the pEGFP-Rab5 vector was maintained in our laboratory. The constructed plasmids were confirmed by sequencing.

Wang L., Li Q., Ni S., Huang Y., Wei J., Liu J., Yu Y., Wang S, & Qin Q. (2019). The roles of grouper clathrin light chains in regulating the infection of a novel marine DNA virus, Singapore grouper iridovirus. Scientific Reports, 9, 15647.

+ Open protocol

+ Expand

Manipulating MSTN Expression via miR-27b-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols

The miR-27b-3p mimic, mimic-NC (negative control), miR-27b-3p inhibitor, inhibitor NC, small interfering RNAs (siRNAs) used for knockdown of MSTN, and non-specific siRNA negative control were designed and synthesized by GenePharma (Suzhou, China). The oligonucleotide sequences are shown in Table 3.
For the overexpression of MSTN, a full-length coding domain sequence (CDS) of the MSTN gene was synthesized by GenePharma (Shanghai, China). The synthesized sequence was inserted into the pcDNA-3.1 vector (Promega, Madison, WI, USA). Moreover, the restriction sites were BamHI and EcoRI.
For the construction of the double luciferase reporter vector, the 3′ UTR region containing the predicted binding site of miR-27b-3p and MSTN was amplified by PCR, and the amplified fragment was cloned into PMIR double luciferase reporter vector, according to the homologous recombination method. The restriction sites were HindIII and mIuI. Moreover, the constructed plasmid was sequenced to check whether the target fragment was inserted successfully. The Fast Mutagenesis Kit V2 (Vazyme, Nanjing, China) was used to construct the mutation vector, according to the instructions. The predicted binding sites were successfully mutated from ACTTGAA to CGCCTGC for the PMIR-MSTN-3′UTR-MT vector. Primers used for vector construction are shown in Table 4.

Zhang G., He M., Wu P., Zhang X., Zhou K., Li T., Zhang T., Xie K., Dai G, & Wang J. (2021). MicroRNA-27b-3p Targets the Myostatin Gene to Regulate Myoblast Proliferation and Is Involved in Myoblast Differentiation. Cells, 10(2), 423.

+ Open protocol

+ Expand

Homology Modeling and Mutagenesis of Sulfatases

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

To explore the probable catalytic mechanisms of PB_3262 and PB_3285, homology modeling of the two enzymes was carried out using SWISS-MODEL software³. Structurally identified chondroitin sulfate/dermatan sulfate 4-O-endosulfatase protein (endoVB4SF) (PDB code: 6J66) (Wang et al., 2019b (link)) and N-acetylgalactosamine-6-sulfatase (GalN6S) (PDB code: 4FDI) (Rivera-Colon et al., 2012 (link)) were used as templates for PB_3262 and PB_3285, respectively. Furthermore, based on the modeling structures of PB_3262 and PB_3285 a series of potential active site residues were predicted and individually mutated to alanine (Ala) via site-directed mutagenesis using a Fast Mutagenesis Kit V2 (Vazyme Biotech Co., Ltd., Nanjing). Primers used for mutants were list in Table 1. The mutants were expressed and their activities were individually estimated using ΔA and ΔC as substrates followed by analyzing with gel filtration HPLC as described for the wild enzymes above.

Wei L., Zhang Q., Lu D., Du M., Xu X., Wang W., Zhang Y.Z., Yuan X, & Li F. (2022). Identification and Action Patterns of Two Chondroitin Sulfate Sulfatases From a Marine Bacterium Photobacterium sp. QA16. Frontiers in Microbiology, 12, 775124.

+ Open protocol

+ Expand

RTN3 Plasmid Manipulation and HUVEC Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

The pcDNA3.1‐flag‐RTN3 plasmid and pcDNA3.1‐myc‐RTN3 plasmid were purchased from Sangon Biotech Company (Shanghai, China). Mutagenesis of RTN3 c.116C>T (pcDNA3.1‐flag‐mutRTN3‐T39M) was performed using Fast Mutagenesis Kit V2 (Vazyme, Nanjing, China).
HUVECs and HEK293 cell lines were obtained from the Cell Bank of Shanghai Institutes for Biological Sciences (Shanghai, China). HUVECs were cultured in Roswell Park Memorial Institute (RPMI‐1640) medium, and HEK293 cells were cultured in Dulbecco's modified Eagle's medium. HUVECs were transfected with the pcDNA3.1‐flag‐RTN3 plasmid. Cells were seeded in 6‐well plates and transfected with RTN3 siRNA (RiboBio, Guangzhou, China) or plasmids for 24 h to operate the scraping line method, transwell, cell tube formation, and 60 μM ABC294640 (APExBIO, Houston, USA) treatment with test after 24 h, or for 48 h to operate WB, ELISA, Co‐IP, 100 μM CHX (Solarbio) treatment, and flow cytometry.

Jin J., Chang S., Chen Y., Liu M., Dong Y., Liu J., Wang Q., Huang H., Fan L, & Xiang R. (2024). Reticulon 3 regulates sphingosine‐1‐phosphate synthesis in endothelial cells to control blood pressure. MedComm, 5(2), e480.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!