Bhp9504 optical analysis system

The luciferase reporter plasmids pGL3-Basic, pGL3-Spry1, and pCDH-Dmrt1 were stored at the Shaanxi Centre of Stem Cells Engineering & Technology, Northwest A&F University. The vectors were constructed by cloning the promoter of Spry1 into the pGL3-Basic plasmid (Promega, USA). A total of 50 ng of pGL3-Basic vector or pGL3-Spry1-promoter supplemented with pCDH-Dmrt1 was co-transfected into TM4 cells in a 48-well plate using transfection reagent Lipo6000, followed by incubation in Opti-MEM for 30 min at 37 °C. A dual-luciferase reporter system (Beyotime, China) was used to evaluate promoter activity (as determined by fluorescence levels) according to the manufacturer’s instructions. Fluorescence levels were assessed using the BHP9504 optical analysis system (Hamamatsu Photonics, Japan) (Wei et al., 2021 (link)).

The luciferase reporter plasmids pGL3-Basic, pGL3-NF-κB, and pCDH-Plzf were stored in the Shaanxi Centre of Stem Cells Engineering & Technology, Northwest A&F University. The vectors were constructed by cloning the promoter of TLR4 into the pGL3-Basic plasmid (Promega, USA). The primers used for TLR4 promoter cloning were F-primer (TAGCTAGCAATATGCTCACGACCTCCG) and R-primer (ATCTCGAGTGCTGTGAGACCAGAGGGG). A total of 50 ng of pGL3-Basic vector or pGL3-TLR4-promoter supplemented with pCDH-Dmrt1 was co-transfected into the mGSCs in a 48-well plate using transfection reagent TurboFect, followed by incubation in Opti-MEM for 30 min at 37 °C. A dual-luciferase reporter system (Beyotime Biotechnology, China) was used to evaluate promoter activity (as determined by fluorescence levels) according to the manufacturer’s instructions. Fluorescence levels were assessed using the BHP9504 optical analysis system (Hamamatsu Photonics, Japan) ( Wei et al., 2018 (link)).