Rhfgf

Manufactured by Promega

Sourced in United States

RhFGF is a recombinant human fibroblast growth factor (FGF) protein produced by Promega. It is a member of the FGF family, which are involved in various cellular processes such as cell growth, differentiation, and tissue repair. RhFGF can be used in cell culture applications to support the growth and maintenance of different cell types.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

RhFGF-basic (4 citations)

12 protocols using rhfgf

Endothelial Cell Culture and Pharmacological Treatments

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human Umbilical Vein Endothelial Cells (Lonza) were amplified in a 37°C incubator with 5% CO2 in endothelial growth media-2 (EGM-2, Lonza) with 5% FBS and 5 ng/ml rhFGF (Promega) and without heparin. Cells between passages 2 and 8 were used for all experiments. When indicated, cells were treated with 5 μM GW4869 (Sigma-Aldrich D1692), 5 μM Src Inhibitor 1 (Sigma-Aldrich S2075), 10 μM ketoconazole (Sanbio 15212-100), or an equivalent volume of DMSO for 48 h, with fresh drug or DMSO added after 24 h. When indicated, cells were treated with 100 ng/ml recombinant human VEGF165 (Peprotech 100-20) or an equal volume of water for 48 h. MDA-MB-231 cells were maintained in a 37°C incubator with 5% CO2 in DMEM with 5% FBS.

O’Grady T., Njock M.S., Lion M., Bruyr J., Mariavelle E., Galvan B., Boeckx A., Struman I, & Dequiedt F. (2022). Sorting and packaging of RNA into extracellular vesicles shape intracellular transcript levels. BMC Biology, 20, 72.

+ Open protocol

+ Expand

Culturing and Differentiating Human Myoblasts

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Three cell lines were used in this study: 54-1 (male), MB135 (female), and HEK293T (female, hypotriploid). Human myoblasts (54-1 and MB135 cells; (Krom et al., 2012 (link); Snider et al., 2010 (link))) were cultured in high serum growth media for proliferation below 60% confluence, and induced to differentiate in low serum differentiation media when the cells reached 99% confluence. The growth media was F-10 media-based (Gibco), and contained 20% fetal bovine serum (Gibco), 1% penicillin/streptomycin (Gibco), rhFGF (10 ng/mL, Promega), and dexamethasone (1 μM, Sigma). The differentiation media was also F-10 media-based (Gibco), and contained 1% horse serum (Gibco), 1% penicillin/streptomycin (Gibco), insulin (10 μg/mL, Sigma), and transferrin (10 μg/mL, Sigma). HEK293T cells used for lentivirus production were obtained from ATCC (CRL-11268) and were cultured in DMEM supplemented with 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Gibco). Cells were cultured at 37°C and 5% CO₂. For myoblast cells, fresh growth media was switched every other day, and cells were split when they reached 50% confluence at ratios of 1:2 or 1:4. For HEK293T cells, cells were split twice per week at a 1:10 ratio.

Feng Q., Jagannathan S, & Bradley R.K. (2017). The RNA surveillance factor UPF1 represses myogenesis via its E3 ubiquitin ligase activity. Molecular cell, 67(2), 239-251.e6.

+ Open protocol

+ Expand

Lentiviral Transduction of Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral plasmids expressing either a non-targeting control shRNA (GCGCGATAGCGCTAATAATTT, Sigma-Aldrich) or a UPF1 3’UTR-targeting shRNA (GCATCTTATTCTGGGTAATAA, TRCN0000022254) were obtained as kind gifts from Dr. Omar Abdel-Wahab. Similar to concentrated lentivirus production above, to produce fresh lentivirus for efficient shRNA delivery and endogenous UPF1 knock-down, HEK293T cells on each 10cm plates, were co-transfected with 10 μg lentiviral plasmid, 2 μg envelope plasmid, and 2 μg packaging plasmid. 16 hours after transfection, fresh myoblast growth media (F-10 (Gibco) with 20% fetal bovine serum (Gibco), 1% penicillin/streptomycin (Gibco), rhFGF(10 ng/mL, Promega), and dexamethasone (1 μM, Sigma)) was changed onto HEK293T cells. 24 hours later, virus-containing myoblast growth media was collected, filtered through 0.45 μM filters, mixed with Polybrene (8 μg/mL, Sigma), and added onto myoblasts ready for shRNA experiments.

Feng Q., Jagannathan S, & Bradley R.K. (2017). The RNA surveillance factor UPF1 represses myogenesis via its E3 ubiquitin ligase activity. Molecular cell, 67(2), 239-251.e6.

+ Open protocol

+ Expand

Immortalized Mouse Myoblasts and Keratinocytes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Immortalized (p53-deficient) plectin^+/+ and plectin^−/− mouse myoblasts [7] (link) and keratinocytes [8] (link) were used. Myoblasts were cultured in F-10 growth medium (GibcoBRL) supplemented with 20% FCS, 1.5% penicillin/streptomycin (Biochrom AG) and 0.1% essential growth factor (rhFGF, Promega). Keratinocytes were cultured in basal keratinocyte growth medium without calcium (Lonza) supplemented with 2% calcium-free (Chelex 100-treated) FCS, 1% insulin-transferrin-selenium (Gibco), 0.4% bovine pituitary extract (Lonza) and 5 µM calcium.

Bonakdar N., Schilling A., Spörrer M., Lennert P., Mainka A., Winter L., Walko G., Wiche G., Fabry B, & Goldmann W.H. (2015). Determining the mechanical properties of plectin in mouse myoblasts and keratinocytes. Experimental Cell Research, 331(2), 331-337.

+ Open protocol

+ Expand

Expansion and Differentiation of Human Primary Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human primary myoblast cell lines were obtained from the University of Rochester biorepository (http://www.urmc.rochester.edu/fields-center/) and were expanded and maintained in DMEM/F-10 (#31550 Gibco/Life Technologies, Bleiswijk, The Netherlands) supplemented with 20% heat inactivated fetal bovine serum (FCS #10270 Gibco), 1% penicillin/streptomycin (#15140 Gibco), 10 ng/mL rhFGF (#G5071 Promega, Leiden, The Netherlands) and 1 μM dexamethasone (#D2915 Sigma-Aldrich, Zwijndrecht, The Netherlands). Differentiation into myotubes was started at 80% confluency by serum starvation in DMEM/F-12 Glutamax (#31331, Gibco) supplemented with 2% KnockOut serum replacement formulation (#10828 Gibco) for 36 h. All samples and their characteristics used for our study are listed in Additional file
1: Table S1. Rhabdomyosarcoma TE-671 were maintained in DMEM (#31966) supplemented with 10% FCS and 1% P/S (all Gibco).

Thijssen P.E., Balog J., Yao Z., Pham T.P., Tawil R., Tapscott S.J, & Van der Maarel S.M. (2014). DUX4 promotes transcription of FRG2 by directly activating its promoter in facioscapulohumeral muscular dystrophy. Skeletal Muscle, 4, 19.

+ Open protocol

+ Expand

Standardized primary myoblast culture

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human primary myoblast cell lines were originating from the University of Rochester bio repository (http://www.urmc.rochester.edu/fields-center/). Muscle samples were obtained after subjects were consented under a protocol approved by the institutional review board at the University of Rochester. Myoblasts were cultured in DMEM/F-10 media (#31550, Gibco/Life Technologies, Bleiswijk, The Netherlands) supplemented with 20% heat inactivated fetal bovine serum (FBS #10270, Gibco/Life Technologies), 1% penicillin/streptomycin (#15140, Gibco/Life Technologies) and 10ng/ml rhFGF (#G5071, Promega, Leiden, The Netherlands) and 1μM dexamethasone (#D2915, Sigma-Aldrich, Zwijndrecht, The Netherlands) was added to the medium. Myoblasts were fused at 80% confluency by culturing them in DMEM/F-12 Glutamax media (#31331, Gibco/Life Technologies) containing 1% penicillin and streptomycin and 2% KnockOut serum replacement formulation (#10828, Gibco/Life Technologies) for 36 h. Human control fibroblast cell lines were maintained in DMEM/F-12, supplemented with 20% FBS, 1% penicillin and streptomycin, 10 mM HEPES (#15630#, Gibco/Life Technologies) and 1mM sodium pyruvate (##11360, Gibco/Life Technologies). Used cell lines, D4Z4 allele information, and experimental use are listed in Table S1.

Balog J., Thijssen P.E., Shadle S., Straasheijm K.R., van der Vliet P.J., Krom Y.D., van den Boogaard M.L., de Jong A., F Lemmers R.J., Tawil R., Tapscott S.J, & van der Maarel S.M. (2015). Increased DUX4 expression during muscle differentiation correlates with decreased SMCHD1 protein levels at D4Z4. Epigenetics, 10(12), 1133-1142.

+ Open protocol

+ Expand

Culturing C2C12 and Primary Human Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

C2C12 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, D5546) supplemented with 10% (v/v) Fetal Bovine Serum (FBS, GIBCO™, Paisley, Scotland) 1% (v/v) Penicillin/Streptomycin (PenStrep, P4333) and 6.8% (v/v) L-Glutamine (200 mM, G7513). The cells were kept at 37 °C in a humidified incubator with 5% CO₂. Primary human myoblasts were cultured in a medium made up of Ham’s F10 Nutrient Mixture Medium (F10, N6013) supplemented with 20% (v/v) Fetal Bovine Serum (FBS, GIBCO™, Paisley, Scotland), 2% (v/v) Penicillin/Streptomycin (PenStrep, P4333), 0.1% (v/v) Gentamicin (GIBCO™, Paisley, Scotland, 50 mg/mL, 15750-060), 6.8% (v/v) L-Glutamine (200 mM, G7513) and 10 ng/mL rhFGF (Promega, Madison, WI, USA, G5071). Cells were passaged with Trypsin-EDTA once 70%–80% confluence was reached.

Steyn P.J., Dzobo K., Smith R.I, & Myburgh K.H. (2019). Interleukin-6 Induces Myogenic Differentiation via JAK2-STAT3 Signaling in Mouse C2C12 Myoblast Cell Line and Primary Human Myoblasts. International Journal of Molecular Sciences, 20(21), 5273.

+ Open protocol

+ Expand

Culturing and Differentiating Primary Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Human primary myoblast cell lines originated from the University of Rochester biorepository (https://www.urmc.rochester.edu/fields-center.aspx). Myoblast cells were grown in DMEM/F-10 medium (Gibco, #31550) with 20% heat-inactivated fetal bovine serum (Gibco, FBS #10270), 1% penicillin/streptomycin (Gibco, #15140), 10 ng/mL rhFGF (Promega, #G5071), and 1 μM dexamethasone (Sigma-Aldrich, #D2915) at 37 °C with 5% CO₂. Myoblast were fused at 80–90% confluency by culturing cells in DMEM GlutaMAX (Gibco, #31966), with 2% KnockOut serum (Gibco, #10828) for 48 h.

Mason A.G., Slieker R.C., Balog J., Lemmers R.J., Wong C.J., Yao Z., Lim J.W., Filippova G.N., Ne E., Tawil R., Heijmans B.T., Tapscott S.J, & van der Maarel S.M. (2017). SMCHD1 regulates a limited set of gene clusters on autosomal chromosomes. Skeletal Muscle, 7, 12.

+ Open protocol

+ Expand

Notoginsenoside R1 Signaling Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols

Notoginsenoside R1 (NGR1, chemical structure C₄₇H₈₀O₁₈, molecular weight = 933, purity >98%) was purchased from Chinese National Institute for the Control of Pharmaceutical and Biological Products. rhEGF and rhFGF were purchased from Promega (Madison, WI). The small molecule inhibitors LY294002 (PI3K/Akt inhibitor), SPD98059 (ERK inhibitor), SB203580 (p38 MAPK inhibitor), SP600125 (JNK inhibitor), BrdU were obtained from Sigma-Aldrich (St. Louis, MO). Primary antibodies against Akt/phospho-Akt, ERK/phospho-ERK, p38/ phospho-p38 and JNK/ phospho-JNK were all purchased from Cell Signaling Technology (Massachusetts, USA). Antibodies against Myosin-11, SMA, Calponin, SM22-α and BrdU were obtained from Abcam (Cambridge, UK). See Supplementary Tables 1-2 for detailed information.

Fang H., Yang S., Luo Y., Zhang C., Rao Y., Liu R., Feng Y, & Yu J. (2018). Notoginsenoside R1 inhibits vascular smooth muscle cell proliferation, migration and neointimal hyperplasia through PI3K/Akt signaling. Scientific Reports, 8, 7595.

+ Open protocol

+ Expand

Lentiviral Transduction of Myoblasts

Check if the same lab product or an alternative is used in the 5 most similar protocols

We used previously described lentiviral constructs expressing full-length
DUX4 or GFP as a control (Geng
et al., 2012). Lentiviral particles were generated by the FHCRC Core Center
of Excellence in Hematology Vector Production Core. Viral particle number was
estimated with the WPRE element within the viral vector. Myoblasts were transduced at
a MOI of ∼15 in the presence of 8 µg/ml polybrene. At this MOI, >85%
of myoblasts were DUX4+ or GFP+. Unless otherwise noted, cells were
collected for analysis 24 hr post-infection. Proliferating myoblasts were cultured in
F-10-based growth media (Gibco, Carlsbad, CA) with 20% fetal bovine serum (Gibco) and
1% penicillin/streptomycin (Gibco), supplemented with 10 ng/ml rhFGF (Promega,
Madison, WI) and 1 µM dexamethasone (Sigma, St. Louis, MO). Growth media was
changed every other day, and proliferating myoblasts were cultured at ≤50%
confluence. To initiate myogenic differentiation, myoblasts were switched to an
F-10-based differentiation media containing 1% horse serum (Gibco) and 1%
penicillin/streptomycin, supplemented with 10 µg/ml insulin (Sigma) and 10
µg/ml transferrin (Sigma) at 99% confluence.

Feng Q., Snider L., Jagannathan S., Tawil R., van der Maarel S.M., Tapscott S.J, & Bradley R.K. (2015). A feedback loop between nonsense-mediated decay and the retrogene DUX4 in facioscapulohumeral muscular dystrophy. eLife, 4, e04996.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!