Mircute enhanced mirna fluorescence quantitative detection kit

The total mRNA of the tissues and cells was extracted using the Total RNA Extraction Kit (A27828, Thermo, USA). cDNA was transcribed using the Maxima First Strand cDNA Synthesis Kit (K1642, Thermo, USA). Subsequently, the Applied Biosystems PowerUp SYBR Green (Thermo, USA) was assessed by quantitative reverse transcription-polymerase chain reaction (RT-qPCR). The miRNA of the tissues and cells was extracted using the miRcute miRNA extraction kit (DP501, Tiangen, China). The cDNA was transcribed using the miRcute miRNA First Strand cDNA Synthesis Kit (KR211, Tiangen, China). Subsequently, RT-qPCR was performed using the miRcute Enhanced miRNA Fluorescence Quantitative Detection Kit (FP411, Tiangen, China). Relative ASF1B expression was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and miR-520d-3p expression was normalized to small RNA U6 (U6). The data were analyzed using the 2-^ΔΔCt method [15 (link)]. All primer sequences are listed in Table 1.Table 1.

The sequence of PCR primers used in this study

Primer name	Sequence
ASF1B	Forward:5ʹ-GATCAGCTTCGAGTGCAGTG-3ʹ
	Reverse:5ʹ-TGGTAGGTGCAGGTGATGAG-3ʹ
miR-193b-3p	Forward:5ʹ-GCGCAACTGGCCCTCAAAGT-3ʹ
	Reverse:5ʹ-GTGCAGGGTCCGAGGT-3ʹ
GAPDH	Forward:5ʹ-CCATCTTCCAGGAGCGAGAT-3’
	Reverse:5ʹ-TGCTGATGATCTTGAGGCTG-3’
U6	Forward:5ʹ-CGCTTCACGAATTTGCGTGTCAT-3’
	Reverse:5ʹ-TATGGAACGCTTCACGAATTTG-3’

MiR-30c, miR-30d and miR-30e-3p were chosen as the candidate miRNAs for microarray data validation. U6 RNA was chosen as an internal control. The 20 μL reverse transcriptase reactions contained 1 μg of RNA and were completed using Mircute enhanced miRNA cDNA first strand synthesis Kit (TIANGEN, China). Real-time PCR was performed using Mircute enhanced miRNA fluorescence quantitative detection kit (TIANGEN, China). The genes of Ubadc1, Ldhb, and Cabc1 were selected to validate the microarray results by Quant one step qRT-PCR Kit (SYBR Green) (TIANGEN, China). β-actin was chosen as an internal control. The sequences of the PCR primers (synthesized by Sangon Biotech Co, China) were shown in Table S1.

Total RNA was collected from cells with TRIzol reagent, and the miRcute Enhanced miRNA cDNA First Strand Synthesis Kit (Tiangen, Beijing, KR211) was used for reverse transcription [21 (link)]. The miRcute Enhanced miRNA Fluorescence Quantitative Detection Kit (Tiangen, Beijing, FP411) was utilized to detect the expression of miR-107 for qPCR, and U6 was employed as the internal reference. The primers were as follows: upstream primer of miR-107, AGCAGCAUUGUACAGGGCUAUCA; and upstream primer of U6, CTCGCTTCGGCAGCACA. The downstream primers were provided by the kit.