Both plasmids, pCpGL-PLIN and pCpGL-basic (no insert), were methylated using SssI methyltransferase (New England Biolabs, Hitchin, UK) according to the manufacturer’s recommendation. In brief, 10–15 µg of plasmid DNA was incubated with or without SssI methyltransferase (20 U/µl; 2 U/µg DNA) in the presence of 640 µM S-Adenosylmethionine (SAM) (New England Biolabs) for four hours at 37 °C, with another 640 µM SAM being added after the first two hours of incubation. Plasmid DNA was purified using QIAquick PCR purification kit (Qiagen). Methylation of plasmid DNA was controlled by digestion using methylation sensitive restriction enzyme HpaII (Thermo Fisher Scientific) for four hours at 37 °C.
Sssi methyltransferase
Manufactured by New England Biolabs
Sourced in United States
SssI methyltransferase is an enzyme that catalyzes the methylation of cytosine residues in DNA. It recognizes and methylates the sequence 5'-CG-3'.
Automatically generated - may contain errors
Lab products found in correlation
Epitect bisulfite kit, by Qiagen (4 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Epitect bisul te kit, by Qiagen (2 mentions)
Dream taqtm hot start pcr master mix, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Mib 1, by Agilent Technologies (1 mentions)
Abc elite kit, by Vector Laboratories (1 mentions)
Methylamp dna modification kit, by Epigentek (1 mentions)
Gotaq hot start polymerase, by Promega (1 mentions)
Wizard miniprep kit, by Promega (1 mentions)
Peasy t1 vector, by Transgene (1 mentions)
Ez dna methylation gold kit, by Zymo Research (1 mentions)
S adenosylmethionine sam, by New England Biolabs (1 mentions)
Hpaii, by Thermo Fisher Scientific (1 mentions)
Qiaquick pcr purification kit, by Qiagen (1 mentions)
Methprimer software, by Sangon (1 mentions)
Platinum sybr green qpcr supermix udg, by Thermo Fisher Scientific (1 mentions)
S adenosylmethionine, by New England Biolabs (1 mentions)
Sds 2, by Thermo Fisher Scientific (1 mentions)
7900 sequence detector, by Thermo Fisher Scientific (1 mentions)
25 protocols using sssi methyltransferase
1
Plasmid DNA Methylation Protocol
2
Methylated Lentiviral Reporter Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We generated an expression vector for human UHRF1 (pCMV-HA-UHRF1, termed pUHRF1). The non-episomal pLTR-Fluc vector was described previously.38 (link) To obtain the pLTRme-Fluc vector, where only the LTR CpGs are methylated, we methylated in vitro the whole pLTR-Fluc construct using the SssI methyltransferase (New England Biolabs, M0226). The LTR fragment was then purified and cloned back in the parental reporter vector and the resulting pLTRme-Fluc vector was directly transfected without bacterial amplification.
3
Glioblastoma Molecular Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tumor proliferation index was analyzed by immunohistochemistry on paraffin sections of glioblastoma samples using the avidin‐biotin‐peroxidase complex methods (ABC‐Elite kit, Vector, Burlingame, CA).14 The anti‐Ki‐67 monoclonal antibody (MIB‐1, Dako) was used. The expression of CD133 and Sox2 in GSCs was evaluated by flow cytometry. O6‐methylguanine DNA methyltransferase (MGMT) promoter methylation patterns were studied by methylation‐specific PCR on genomic DNA.15 DNA from normal lymphocytes treated with SssI methyltransferase (New England Biolabs, Ipswich, MA) was used as positive control. PCR products were separated onto 3% agarose gel, stained with ethidium bromide and visualized under UV illumination.
4
MGMT Methylation Analysis by MS-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After DNA modification with Methylamp DNA Modification Kit (Epigentek, Farmingdale, NY, USA), MS-PCR for MGMT were determined as described previously (Martini et al, 2008 (link)). Briefly, bisulphite-modified DNA (100–200 ng) was amplified in a mixture containing 1 × PCR buffer (20 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2), deoxynucleotide triphosphates (0.2 mM each), primers (20 pM each) and 0.75 U GoTaq Hot Start polymerase (Promega, Madison, WI, USA) in a final volume of 25 μl. Polymerase chain reaction conditions were: an initial denaturation of 95 °C for 8 min, followed by 35 cycles of 95 °C for 60 s, 60 °C for 60 s and 72 °C for 60 s. Polymerase chain reaction products were electrophoresed in a 2.5% agarose gel, stained with ethidium bromide and visualised under ultraviolet illumination. Methylation-specific-PCR analysis was performed in duplicate for all samples. Normal lymphocyte DNA supermethylated with SssI methyltransferase (New England Biolabs, Beverly, MA, USA) and treated with bisulphite was used as the unmethylated and methylated control, water as a negative control and untreated DNA as an internal PCR control. We also carried out MS-PCR on granulocyte DNA obtained from 10 healthy individuals, as the control group.
5
Methylation Analysis of DNA Samples
6
NRG1 Exon 1 DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The QIAamp DNA Mini Kit (QIAGEN, Valencia, CA) was used to extract the total DNA from 16 HSCR patients and 17 control colons. Subsequently, the total DNA was determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Only high-quality DNAs with the OD260/280 ratios of 1.8 to 2.0 were utilized for the subsequent experiment.
DNA genomic (500 ng) was treated with sodium bisulfite using EZ DNA Gold Methylation Kit (ZYMO, USA), then continued with PCR. NRG1 exon 1 methylation was analyzed using the following primers as follows: methylated forward: 5’-GTTTTAGCGCGGTCGTTC-3’, methylated reverse: 5’-CGAACTCCGACTTCTTACCG-3’; unmethylated forward 5’-GTAGTGTGAGTGTTTTAGTGTGGTTG-3, unmethylated reverse: 5’CAAACTCCAACTTCTTACCA-3’. PCR products were then run on gel agarose 2% using fluorosafe. Positive methylation DNA controls used methylated samples with SssI methyltransferase (New England Biolabs, MA, USA) for the methylation-specific PCR (MS-PCR) [13 (link)].
DNA genomic (500 ng) was treated with sodium bisulfite using EZ DNA Gold Methylation Kit (ZYMO, USA), then continued with PCR. NRG1 exon 1 methylation was analyzed using the following primers as follows: methylated forward: 5’-GTTTTAGCGCGGTCGTTC-3’, methylated reverse: 5’-CGAACTCCGACTTCTTACCG-3’; unmethylated forward 5’-GTAGTGTGAGTGTTTTAGTGTGGTTG-3, unmethylated reverse: 5’CAAACTCCAACTTCTTACCA-3’. PCR products were then run on gel agarose 2% using fluorosafe. Positive methylation DNA controls used methylated samples with SssI methyltransferase (New England Biolabs, MA, USA) for the methylation-specific PCR (MS-PCR) [13 (link)].
7
Methylation-Specific PCR Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We selected ER1, ER3, ER4 and ER5 for MSP from the six primer pairs previously described (8 (link),9 (link)) because these covered the most significant methylated loci. The oligonucleotides of primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). PCR was carried out initial denaturation at 95°C for 10 min, followed by 14 cycles of 94°C for 30 sec, 62°C (ER1) or 59°C (ER3, ER4 and ER5) for 45 sec (−0.5°C decreased/each cycle), 72°C for 1 min, then followed by 30 cycles of 94°C for 30 sec, 55°C (ER1) or 52°C (ER, ER4 and ER5) for 45 sec, 72°C for 45 sec, ending with a final extension of 72°C for 10 min and a quick chill to 4°C. The products were subjected to 3% agarose gel electrophoresis at 100 V for 60 min and visualized by UV light. DNA from lymphocytes of healthy volunteers treated with SssI methyltransferase (New England Biolabs, Beverly, MA, USA) and then subjected to bisulfite modification was used as positive control for methylated alleles and water was used as negative controls.
8
Methylation-specific PCR for SM22α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation-specific PCR primers were designed using MethPrimer software (Sangon Biotech Co., Ltd., Shanghai, China). The primers for methylated SM22α were as follows: 5′-AATAGTGAAGTAGGAGTAGTCGTAAGTTC-3′ (forward) and 5′-AATCTACCGAAACTACCGAAAC-3′ (reverse). The primers for unmethylated SM22α were as follows: 5′-GAATAGTGAAGTAGGAGTAGTTGTAAGTTT-3′ (forward) and 5′-CAATCTACCAAAACTACCAAAAC-3′ (reverse). The PCR reaction contained Platinum SYBR-Green qPCR SuperMix-UDG (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) (12.5 µl), template DNA (1 µl), primers (each 0.5 µl) and diethylpyrocarbonate H2O (10.5 µl). The thermocycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 40 cycles at 95°C for 30 sec, annealing at 64°C for 30 sec, elongation at 72°C for 45 sec and extension at 72°C for 10 min. The PCR product for methylated and unmethylated SM22α was 149 and 151 bp, respectively. Amplification products were analyzed by 2% agarose gel electrophoresis. Peripheral blood DNA that was treated with SssI methyltransferase (New England BioLabs, Inc., Ipswich, MA, USA) was used as a positive control and deionized water was used as a negative control. The gel was visualized under UV illumination.
9
Methylation Analysis of NDRG2 Promoter
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite treatment of genomic DNA was performed as previously described[33 (link)], using glycogen as carrier, and the precipitated DNA was redissolved in TE buffer, amplified by PCR and sequenced directly. The primers were designed to cover 16 CpG sites in the promoter region in NDRG2 (Figure 1A ) and their sequences were (5’-3’): TTTTCGAGGGGTATAAGGAGAGTTTATTTT and CCAAAAACTCTAACTCCTAAATAAACA[34 (link)]. A positive control with in vitro methylated (IVM) DNA was prepared by mixing 2 μL NEB2 buffer, 1 μL 20 x S-adenosylmethionine (New England Biolabs, B9003S), 200 ng reference human genomic DNA and 1 µL SssI methyltransferase (New England BioLabs, M0226S) in a total of 20 μL. Samples were incubated at 37 °C overnight with occasional addition of 2 μL 20 x S-adenosylmethionine to ensure sufficient methyl-donor substrate. The following description was used for each CpG site: Unmethylated (no methylation signal); weakly methylated (methylation signal was less than or approximately equal to unmethylated signal); and strongly methylated (methylation signal was greater than unmethylated signal).
10
Quantitative Methylation Analysis of TMEM16A
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The method of methylation analysis was similar to that described by Shiwarski et al.11 (link). Briefly, the EpiTect Bisulfite Kit (Qiagen) was used to convert unmethylated cytosines in DNA to uracil according to the manufacturer’s instructions. Quantitative methylation-specific PCR (qMSP) was carried out in a 7900 sequence detector (Perkin-Elmer Applied Biosystems, Carlsbad, CA) and analyzed by a sequence detector system (SDS 2.3; Applied Biosystems). The TMEM16A qMSP primer sequences designed were: Forward 5′- AGGATCGTAGCGTTTATATTA -3′, and Reverse 5′- CGCGACCCTCCCGCC -3′. The TMEM16A qMSP probe sequence was 6FAM 5′- CGCACTCACCGTACCCTCG -3′ TAMRA.
Leukocyte DNA from a healthy individual was methylated in vitro with excess SssI methyltransferase (New England Biolabs, Inc., Ipswich, MA) to generate completely methylated DNA. Serial dilutions (30–0.003 ng) of this bisulfite-treated methylated DNA were used to construct a calibration curve. All data points were within the range of sensitivity and reproducibility of the assay based on the calibration curve. The methylation levels in each sample were determined as a ratio of qMSP-amplified gene to β-actin (reference gene) and then multiplied by 1000 for easier tabulation (average value of gene triplicates divided by the average value of β-actin triplicates × 1000).
Leukocyte DNA from a healthy individual was methylated in vitro with excess SssI methyltransferase (New England Biolabs, Inc., Ipswich, MA) to generate completely methylated DNA. Serial dilutions (30–0.003 ng) of this bisulfite-treated methylated DNA were used to construct a calibration curve. All data points were within the range of sensitivity and reproducibility of the assay based on the calibration curve. The methylation levels in each sample were determined as a ratio of qMSP-amplified gene to β-actin (reference gene) and then multiplied by 1000 for easier tabulation (average value of gene triplicates divided by the average value of β-actin triplicates × 1000).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!