Quantstudio 3 rt pcr system

The PureLink RNA Mini Kit (Thermo Fisher Scientific) was used to isolate RNA from whole intact right tibiae. To obtain RNA from CD11b⁺ and CD11b^- bone marrow cells from right and left intact femora and tibiae with the AllPrep DNA/RNA Kit (Qiagen), harvested bone marrow cells were separated by Magnetic Cell Separation (MACS) using CD11b MicroBeads UltraPure (Miltenyi Biotec) and the QuadroMACS Separator (Miltenyi Biotec). After RNA isolation, one-step semi-quantitative Real-Time-Polymerase-Chain-Reactions (RT-PCRs) were performed with the SensiFAST SYBR Hi-ROX One-Step Kit (Bioline) and the QuantStudio 3 RT-PCR System (Thermo Fisher Scientific) according to the manufacturer’s guidelines. The relative gene expression of CXCL1 (F: 5’-TCTCCGTTACTTGGGGACAC-3’, R: 5’-CCACACTCAAGAATGGTCGC-3’), CCL2 (F: 5’-GGCTCAGCCAGATGCAGTT-3’, R: 5’-TCTCCAGCCTACTCATTGGGA-3’), IL6 (F: 5’-TCCTTCCTACCCCAATTTCC-3’, R: 5’-GCCACTCCTTCTGTGACTCC-3’), IL4 (F: 5’-CCACGGATGCGACAAAAATCA-3’, R: 5’-GTGCATGGCGTCCCTTCTC-3’), IL10 (F: 5’-GGCAGAGAAGCATGGCCCAGAAATC-3’, R: 5’-ACTCTTCACCTGCTCCACTGCCT-3’), TNF (F: 5’-GGCCACCACGCTCTTCTGTCTACT-3’, R: 5’-TGATCTGAGTGTGAGGGTCTGGGC-3’) and IL1B (F: 5’-ACAAGGAGAACCAAGCAACG-3’, R: 5’-GGGTGTGCCGTCTTTCATTA-3’) was determined with the delta-delta CT (ΔΔCT) method. B2M (F: 5’-ATACGCCTGCAGAGTTAAGCA-3’, R: 5’-TCACATGTCTCGATCCCAGT-3’) was used as the housekeeping gene.

Total RNA from right ventricles was extracted using TRIzol Reagent (15596026, Invitrogen, Carlsbad, CA, USA). Sample purity was confirmed measuring a 260/280 nm absorbance ratio using a Take3 multivolume plate in a Synergy HT microplate reader (BioTek Instruments, Winooski, USA). SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline, London, UK) was used to reverse-transcribe cDNA from 1 μg of total RNA. qPCR reaction was performed using the SensiFAST SYBR Lo-ROX Kit (BIO-94020, Bioline, London, UK) in a Quant-Studio 3 RT PCR System (Thermo Fisher Scientific, Waltham, TX, USA). Data was analyzed by 2−ΔΔCt method to estimate mRNA expression from each gene [15 (link), 34 (link)]. T4 Oligo (Mexico) synthesized primers. Primer sequences are detailed in Supplementary Table 1.

Tissues were homogenized in TRIzol (Invitrogen) for RNA extraction according to the manufacturer’s protocol. Reverse transcription was done using SuperScript II RT (Invitrogen) and qRT-PCR was performed using SYBR FAST Universal 2X qPCR Master Mix (Kapa) on a QuantStudio 3 RT-PCR System (Thermo Fisher Scientific). All samples were run in triplicate and the CT value was normalized to calculate relative expression of each gene. The fold expression was calculated using the ΔΔCt method with Gapdh as a reference gene.

Total RNA from the tissue of the ventricles was isolated using a TRIzol Reagent (15596026, Invitrogen) to evaluate brain natriuretic peptide (BNP) mRNA expression. Purity of all samples was confirmed by measuring their 260/280 nm absorbance ratio using a Take3 multivolume plate in a Synergy HT microplate reader (BioTek Instruments). cDNA was reverse-transcribed from 1 μg of total RNA using the SensiFAST cDNA Synthesis Kit (BIO-65053, Bioline) and used for qPCR using the SensiFAST SYBR Lo-ROX Kit (BIO-94020, Bioline) in a QuantStudio 3 RT PCR System (Thermo Fisher Scientific). Data were analyzed by the 2−ΔΔCt method to estimate each gene’s mRNA expression. The primers specific for each gene were: 5′ CTCCAGAACAATCCACGAT 3′/5′ CTTGAACTATGTGCCATCTTG′ (BNP) and 5′ CGTGATTAGTGATGATGAACC 3′/5′ GAGCAAGTCTTTCAGTCCT 3′ (HPRT).

RNA was isolated from liver using a Quick-RNA MiniPrep Kit (Zymo Research) and then used for cDNA synthesis using a QuantiTect Reverse Transcriptase Kit (Qiagen), both according to manufacturer's instructions. Quantitative PCR was performed using the Applied Biosystems QuantStudio3 RT‐PCR System and PowerUp SYBR Green Master Mix (Thermo Fisher). Primer sequences for the following genes were designed with IDT Real Time PCR tool and were as follows: Gapdh (F 5′-GTGGCAGTGATGGCATGGAC; R 5′-CAGCACCAGTGGATGCAGGG), F4/80 (F 5′-CCAGCACATCCAGCCAAG; R 5′-ACATCAGTGTTCCAGGAGACACA), Cd68 (F 5′-TGCGGCTCCCTGTGTGT; R 5′-TCTTCCTCTGTTCCTTGGGCTAT). Primers for Ccl2, Ccl4, Il-1β, Il-6, Col1al, Col3a1 were commercially predesigned and validated primers (QuantiTect Primer Assays, Qiagen) and sequences are proprietary. The efficiency of each primer set was determined from a four point standard curve and used to calculate relative expression using Gapdh as reference gene. Data are expressed as the fold‐change in relative expression relative to controls.

cDNA was generated from total RNA using the High Capacity cDNA Reverse Transcriptase Kit (ThermoFisher CAT# 4368814) according to the manufacturer’s instructions, using 1000 ng RNA per reaction, with a final volume of 20 µL per reaction. Reactions were incubated in a MyCycler thermocycler (BioRad) with the following cycles: 25 °C for 10 min, 37 °C for 120 min, 85 °C for 5 min, 4 °C until sample retrieval. qPCR was performed using the Brilliant II SYBR Green Master Mix (Agilent Technologies CAT# 600828) according to the manufacturer’s instructions with a 10 µL reaction volume. Cycling was performed in a QuantStudio 3 RT-PCR system (ThermoFisher). Data analysis was performed using the QuantStudio Design and Analysis Software v1.1.0, using the 2^−ΔΔCT method to calculate fold-change relative to controls. Primers (Supplementary Table S1) were purchased from Invitrogen.