Anti h3k9me2 antibody

Cultured MEFs were washed with cold PBS buffer and then lysed with KALB lysis buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.5, 1 % (v/v) Triton X-100, 1 mM EDTA pH 7.5) supplemented with 1 mM sodium vanadate, 1 mM PMSF and protease inhibitors (complete mixture tablets; Roche) on ice for 30 min. Insoluble material was removed by centrifugation at 15,000 g at 4°C for 5 min. Total protein concentration in the whole cell extract was quantified using the BCA protein assay kit (Pierce) following manufacturer’s instructions. Proteins were resolved by 4–12 % SDS-PAGE (Invitrogen), transferred to PVDF membranes (Osmonics; GE) and blocked with 5 % (w/v) skim milk powder in 0.1 % (v/v) Tween-PBS for 1 h at room temperature. Membrane was incubated overnight with anti-Setdb1 antibody (1:2000 diluted; Santa Cruz, sc-66884) and anti-Actin antibody (1:2000 diluted; Santa Cruz, sc-1616), anti-H3K27me3 antibody (1:2500; Millipore 07-449), anti-H3K9me2 antibody (a:1000; Abcam, ab1220), anti-H3K9me3 (1:1000; Millipore, 07-442) at 4 °C followed with horseradish peroxidase (HRP)-conjugated secondary antibodies. Membrane was visualised using ECL system (Immobilon; Millipore) following manufacturer’s instructions.

ChIP for H3K9me2 was previously described [15 (link)]. ChIP for H4K16ac and H3K4me2 followed a similar procedure with the following modifications: neutrophils were isolated by HetaSep (StemCell Technologies, Vancouver, BC, Canada). Cells (5 × 10⁶ cells/ml/sample) were incubated with formaldehyde at a final concentration of 0.6 % to crosslink DNA and proteins, and then lysed and sonicated in lysis buffer without SDS (10 mM Tris-HCl, pH 8.0; 100 mM NaCl; 1 mM EDTA, pH 8.0; 0.5 mM EGTA; 0.1 % Na-Deoxycholate; 0.5 % N-Lauroylsarcosine). After sonication, lysate was diluted 1:1 in lysis buffer and Triton X-100 was added to 1 % final concentration. Anti-H3K9me2 antibody was purchased from Abcam (Abcam, Cambridge, MA), and anti-H3K4me2, H4K16ac, and H3K9,14ac antibodies from Millipore (EMD Millipore, Billerica, MA). Primers for Q-PCR of PRTN3 and MPO promoter regions and control MYO-D were previously published [15 (link)]. FCGR3B promoter, sense primer (CCACCATAGAACAGGAATAG) and antisense primer (AGACCTTTGGGAGAGTAAA) were from Integrated DNA Technologies (Integrated DNA Technologies, Coralville, IA). Specific DNA was analyzed by quantitative PCR and expressed as a relative percent of input chromatin. The level of enrichment for the indicated histone modification was calculated using raw Ct values from qPCR of diluted input sample.

Western blot analyses were performed by growing cells in 10-cm dishes, harvesting, and lysis with RIPA buffer containing 1× protease inhibitor mixture (Roche Applied Science) and 1× phosphatase inhibitor (Thermo Scientific). Cell lysate was agitated on ice for 20 min prior to centrifugation at 14,000 rpm for 15 min at 4 °C in a microcentrifuge. Extracts were analyzed by electrophoresis through 10% BisTris-polyacrylamide gels under reducing conditions with detection by Western blotting using anti-HIF-1α antibody (BD Biosciences 610958, 1:1000), anti-HIF-2α antibody (Novus Biologicals 100-122, 1:1000), anti-H3K9me2 antibody (Abcam 1220, 1:1000), anti-H3K9me3 antibody (Millipore 07-442, 1:500), anti-H3K27me2 antibody (Abcam 24684, 1:1000), anti-H3K27me3 antibody (Millipore 05-1951, 1:15,000), anti-H3 antibody (Santa Cruz Biotechnology 10809, 1:1000), anti-HDAC6 antibody (Cell Signaling 7558S, 1:1000), anti-JMJD2D antibody (Abcam 93694, 1:200), anti-TET1 antibody (Abcam 156993, 1:1000), or anti-actin antibody (Sigma A2066, 1:500). Secondary antibodies were anti-rabbit- and anti-mouse-conjugated to a horseradish peroxidase (Promega, 1:15,000), and signals were developed using an ECL plus kit (Pierce).