Mxpro mx3005 p real time pcr system
The MxPro-Mx3005 P Real-time PCR system is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of detecting and quantifying specific nucleic acid sequences in real-time during the amplification process.
Lab products found in correlation
5 protocols using mxpro mx3005 p real time pcr system
Quantitative mRNA Expression Analysis of Ischemic Stroke
Quantitative RT-PCR Analysis of FLG and GAPDH
Quantitative PCR Analysis of Gene Expression
Quantitative Analysis of MGMT Expression in GBM Cells
GAPDH: 5′-ATCATCCCTGCCTCTACTGG-3′ (forward),
GAPDH: 5′-GTCAGGTCCACCACTGACAC-3′(reverse);
MGMT: 5′- GTTTTCCAGCAAGAGTCGTTC -3′ (forward),
MGMT: 5′- GCTGCTAATTGCTGGTAAGAAA-3′ (reverse).
GAPDH served as the internal reference.
Quantitative Real-Time PCR Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!