The brain cortex was harvested 24 h after MCAO/R for quantitative real-time PCR (qRT-PCR). Tissue samples were homogenized in TRIzol reagent (Invitrogen, Carlsbad, CA, United States). Total cellular RNA was extracted and transcribed to cDNA using the PrimeScript RT Reagent kit (Thermo Fisher Scientific). The primers were synthesized by Sangon Biotech (Shanghai, China; Table 2 and Supplementary Table 1 ). Quantitative PCR was performed using the HieffTM qPCR SYBR Green Master Mix (Low Rox Plus) (Yisheng Biotech, Shanghai, China) on the MxPro-Mx3005 P Real-time PCR system (Agilent Technologies, United States). The mRNA expression levels were calculated using the 2-ΔΔCt method and normalized to the quantity of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA.
Mxpro mx3005 p real time pcr system
Manufactured by Agilent Technologies
Sourced in United States, China
The MxPro-Mx3005 P Real-time PCR system is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It is capable of detecting and quantifying specific nucleic acid sequences in real-time during the amplification process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Sybr premix ex taq, by Takara Bio (2 mentions)
Primescript rt reagent kit, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Transscript one step gdna removal and cdna synthesis supermix kit, by Transgene (1 mentions)
Sybr green pcr master mix, by Transgene (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
5 protocols using mxpro mx3005 p real time pcr system
1
Quantitative mRNA Expression Analysis of Ischemic Stroke
2
Quantitative RT-PCR Analysis of FLG and GAPDH
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from bladder cancer cell lines 5637 and T24 using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For first-strand cDNA synthesis, 1 µg of total RNA was reverse-transcribed in a 20 µL reaction using the PrimeScript RT Reagent kit (Takara Bio, Kusatsu, Japan). The cDNA samples were amplified in triplicate via qRT-PCR using the MxPro-Mx3005P Real Time PCR system (Agilent Technologies, Santa Clara, CA, USA) and SYBR Premix ExTaq (Takara Bio) according to the manufacturer’s instructions. The qRT-PCR cycling conditions were as follows: initial denaturation at 95 ℃ for 1 min, 95 ℃ for 35 s, and annealing at 60 ℃ for 35 s for 40 cycles. The 2−ΔΔCT method, with GAPDH as the internal control, was used to determine relative mRNA expression. The fluorescent signals were measured after each primer-annealing step at 60 ℃. The primer sequences for FLG and GAPDH were as follows:
3
Quantitative PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Briefly, whole blood samples were homogenized in Trizol reagent (Invitrogen, Carlsbad, CA, USA) before total cellular RNA was extracted and transcribed to cDNA with a PrimeScript RT Reagent kit (Invitrogen). Quantitative PCR was subsequently performed by using HieffTM qPCR SYBR Green Master Mix (Low Rox Plus; Yisheng Biotech, Shanghai, China) with the MxPro-Mx3005 P Real-time PCR system (Agilent Technologies, Palo Alto, CA, USA). All primer oligos were synthesized by Sangon Biotechnology (Shanghai, China; listed in Table 2 ). Levels of mRNA expression were standardized to the mRNA level of glyceraldeyhyde 3-phosphate deydrogenase (GAPDH). Relative quantification was subsequently performed according to the comparative threshold cycle (2-ΔΔCT) method.
4
Quantitative Analysis of MGMT Expression in GBM Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol (Invitrogen, Carlsbad, CA, USA) was utilized to isolate the total RNA based on GBM cells in accordance with manufacturer protocols. Later, the TransScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Transgen Biotech, Beijing, China) was used to prepare cDNA from the extracted RNA. Later, the SYBR green PCR master mix (TransGen Biotech, China) was utilized to perform qRT-PCR onto the MxPro-Mx3005 P Real-time PCR system (Agilent Technologies, USA). All primers used in this assay were prepared via Sangon Biotech (Shanghai, China), including:
GAPDH: 5′-ATCATCCCTGCCTCTACTGG-3′ (forward),
GAPDH: 5′-GTCAGGTCCACCACTGACAC-3′(reverse);
MGMT: 5′- GTTTTCCAGCAAGAGTCGTTC -3′ (forward),
MGMT: 5′- GCTGCTAATTGCTGGTAAGAAA-3′ (reverse).
GAPDH served as the internal reference.
GAPDH: 5′-ATCATCCCTGCCTCTACTGG-3′ (forward),
GAPDH: 5′-GTCAGGTCCACCACTGACAC-3′(reverse);
MGMT: 5′- GTTTTCCAGCAAGAGTCGTTC -3′ (forward),
MGMT: 5′- GCTGCTAATTGCTGGTAAGAAA-3′ (reverse).
GAPDH served as the internal reference.
5
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For first‐strand cDNA synthesis, 1 μg of total RNA was reverse‐transcribed in a 20 μL reaction using the PrimeScript RT Reagent Kits (Takara Bio, Kusatsu, Japan). cDNA samples were amplified in triplicate via qRT‐PCR using the MxPro‐Mx3005P Real‐Time PCR system (Agilent Technologies, Santa Clara, CA, USA) and SYBR Premix Ex Taq (Takara Bio) according to the manufacturer's instructions. All primers used are listed in Table S1 . The qRT‐PCR cycling conditions were the following: initial denaturation at 95°C for 1 min, 95°C for 35 s, and annealing at 60°C for 35 s for 40 cycles. The 2−ΔΔCT method, with β‐actin as internal control, was used to determine the relative expression. The fluorescent signals were measured after each primer‐annealing step at 60°C.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!