Panc1 (CRL-1469) and 293T (CRL-3216) cells were purchased from ATCC. mT3 and mT4 mouse PDAC cell lines were provided by Dr. Tuveson (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) and authenticated by genotyping PCR to compare with Kras+/LSL-G12D; Trp53+/LSL-R172H; Pdx1-Cre (KPC) model87 (link). Established primary PDAC cell lines were authenticated by genotyping PCR to compare with the corresponding mice. Lentiviral plasmids pTRIPZ, TLCV2, and pCW57 were purchased from Addgene. Specific shRNA and sgRNA sequences were listed in Supplementary Table 4 . Gateway Entry plasmids for SOX2 (HsCD00436328), SOX5 (HsCD00442638), TWIST2 (HsCD00330331), and NR2F2 (HsCD00005215) were purchased from DNASU (Tempe, AZ), and transferred into the pCW57 destination vector using Gateway LR Clonase II Plus (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions. Lentiviral production was performed as previously described17 (link). For pTRIPZ or TLCV2-infected PDAC cells, puromycin selection was used to eliminate uninfected cells. For pCW57-infected PDAC cells, FACS was used to purify PDAC cells carrying overexpressing vectors. Cells were grown in DMEM supplemented with 10% Fetal Bovine Serum and 1% Pen/Strip (Thermo Fisher Scientific). All cell lines were free of mycoplasma infection using PlasmoTest Mycoplasma Detection Kit (InvivoGen, San Diego, CA).
Tlcv2
Manufactured by Addgene
The TLCV2 is a laboratory device designed for thin-layer chromatography (TLC) applications. It serves as a compact and versatile tool for performing chromatographic separations and analysis of chemical compounds. The TLCV2 provides a controlled environment for conducting TLC experiments, enabling researchers to efficiently carry out their analytical workflow.
Automatically generated - may contain errors
Lab products found in correlation
Pen strip, by Thermo Fisher Scientific (1 mentions)
Plasmotest mycoplasma detection kit, by InvivoGen (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Panc 1, by American Type Culture Collection (1 mentions)
Ptripz, by Addgene (1 mentions)
Pcw57, by Addgene (1 mentions)
Puromycin, by Thermo Fisher Scientific (1 mentions)
Doxycycline, by Solarbio (1 mentions)
Lenticrispr v2, by Addgene (1 mentions)
Pentr d topo, by Thermo Fisher Scientific (1 mentions)
Pentr d, by Thermo Fisher Scientific (1 mentions)
Plx304, by Addgene (1 mentions)
Attractene transfection reagent, by Qiagen (1 mentions)
Polybrene tr 1003 g, by Merck Group (1 mentions)
Vsv g, by Addgene (1 mentions)
5 protocols using tlcv2
1
Cell Line Authentication and Overexpression in Pancreatic Cancer
2
CRISPR-Mediated Modulation of INTS3 in Colorectal Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The sgRNA sequences (sgINTS3 #3, TGGGGATTATGGTCTCCAG; sgINTS3 #4, CTGTCCTGCAGTGATACGG) were obtained from RBP pooled CRISPR knockout library and cloned into TLCV2 (Addgene, # 87360). Lentivirus was generated by HEK293T and infected SW620. SW620-sgINTS3 cells and control cells were treated with 2 mg/mL puromycin (Thermofisher Scientific, A1113802). INTS3 KO was induced by 1μg/mL doxycycline (Solarbio Life Sciences, D8960).
All shRNA oligos (shINTS3 #1, GGATCTCGTAAGACTACTTCA; shINTS3 #2, GCAGAAAGTGTTCTGGATATC; mshINTS3, GCTGCTACTTTCAACCAGTTT) were cloned into pSicoR-mCherry-empty (Addgene, # 21907). SW620, HCT116 and RKO were transduced with pSicoR-mCherry-empty or pSicoR-mCherry-INTS3 vector. Mcherry positive cells were sorted by FACSympony S6 system (BD Biosciences) for the downstream assays.
The CDS sequence of INTS3 was cloned in pLVX-puro vector. The pLVX-INTS3-puro vector or pLVX-puro vector was transfected into SW620. SW620-oeINTS3 and SW620-oeControl cells were treated with 2 mg/mL puromycin for the in vitro assays (Thermofisher Scientific, A1113802).
All shRNA oligos (shINTS3 #1, GGATCTCGTAAGACTACTTCA; shINTS3 #2, GCAGAAAGTGTTCTGGATATC; mshINTS3, GCTGCTACTTTCAACCAGTTT) were cloned into pSicoR-mCherry-empty (Addgene, # 21907). SW620, HCT116 and RKO were transduced with pSicoR-mCherry-empty or pSicoR-mCherry-INTS3 vector. Mcherry positive cells were sorted by FACSympony S6 system (BD Biosciences) for the downstream assays.
The CDS sequence of INTS3 was cloned in pLVX-puro vector. The pLVX-INTS3-puro vector or pLVX-puro vector was transfected into SW620. SW620-oeINTS3 and SW620-oeControl cells were treated with 2 mg/mL puromycin for the in vitro assays (Thermofisher Scientific, A1113802).
3
Lentiviral Plasmid Cloning for NFKB2 Knockout
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cloning of lentiviral plasmidsFor KMS11, gRNAs were designed using the Broad Institute GPP sgRNA Designer/CRISPick113 (link) to target exon 6 of NFKB2. They were then cloned into TLCV2 (Addgene plasmid # 87360, a gift from Adam Karpfand) as previously described114 (link),115 (link). The following oligos were used to generate the TLCV2-NFKB2-Ex6 plasmid: NFKB2Ex6F: CACCTCCTAGATCTGTAACTACGA, NFKB2Ex6R: AAATCGTAGTTACAGATCTAGGAA. The plasmids were transformed into competent Stbl3™ bacteria via heat shock at 42 °C and plated on LB agar plates containing Ampicillin which were incubated overnight at 37 °C. Cycle sequencing (BigDye Terminator v3.1; 1st Base) was conducted to verify the success of cloning.
For NFKB2 knock down in MM.1.144, sgRNA targeting exon 6 of NFKB2 was cloned into lentiCRISPR v2 (Addgene plasmid # 52961), which is a constitutive CRISPR system. The guide sequence and cloning protocol followed are similar to that used for KMS11.
For NFKB2 knock down in MM.1.144, sgRNA targeting exon 6 of NFKB2 was cloned into lentiCRISPR v2 (Addgene plasmid # 52961), which is a constitutive CRISPR system. The guide sequence and cloning protocol followed are similar to that used for KMS11.
4
Generation of Lenti-mCherry-SEpHluorin and NHE1 KO Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pLX304 lenti-mCherry-SEpHluorin plasmid was generated by inserting an mCherry-SEpHluorin fragment from an mCherry-SEpHluorin plasmid (Addgene #32001) into lentiviral vector pLX304 (Addgene #25890). The mCherry-SEpHluorin fragment was first amplified and then cloned into the Gateway entry vector pENTR/D-TOPO (Thermofisher) to build pENTR/D-mCherry-SEpHluorin. The mCherry-SEpHluorin fragment was then transferred from pENTR/D-mCherry-SEpHluorin into pLX304 via LR gateway reaction to build pLX304 lenti-mCherry-SEpHluorin. To generate the pTLCV2 NHE1 KO plasmid, guide RNA targeting the first exon of the mouse NHE1 gene was designed and cloned into an all-in-one doxycycline (Dox)-inducible vector TLCV2 (Addgene #87360). In brief, gRNA oligo forward (5’-caccgAACTTAATCATTGAACATGG-3’) and reverse (5’-aaacCCATGTTCAATGATTAAGTTc-3’) were first annealed and then ligated into BsmBI digested TLCV2 vector.
5
Generating Inducible CRISPR Lentivirus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MacroH2A1 guide RNA (gRNA, see Table 3 ) was cloned into TLCv2 (plasmid: 87360; Addgene), a plasmid encoding doxycycline-inducible Cas9-2A-GFP and gRNA expression. To generate lentiviral particles, 1.0 × 107 HEK293T cells were transfected with 12 µg TLCv2_sg_mH2A1, 8 µg pMDL (plasmid: 12251; Addgene), 4 µg VSVg, and 2.5 µg pREV (plasmid: 115989; Addgene) using Attractene transfection reagent (301005; Qiagen). Lentivirus was harvested at 24-, 48-, and 72-h posttransfection, filtered through 0.2-µm filters, aliquoted, flash-frozen with liquid nitrogen, and stored at −80°C. 2 ml of thawed filtered lentivirus was used to transduce ∼2.25 × 106 HFF-T or 3 × 106 RPE cells in 10-cm plates with 8 µg/ml polybrene (TR-1003-G; Millipore-Sigma). Cells were allowed to reach confluence before selection with 1 µg/ml puromycin for 3 d. Cells were then sorted by GFP positivity or counted by hemocytometer, plated at one cell per well into 96-well plates, and selected through serial expansion of colonies. Selected cells were screened for macroH2A1 knockout by Western blot.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!