Geneart gene synthesis

Cytolytic fusion proteins containing granzyme B variant R201K or MAPTau were expressed in HEK 293T cells. The synthetic TTC DNA sequence (GenBank accession no. FJ917402.1) prepared by GeneArt^® Gene Synthesis (Thermo Fisher Scientific) was flanked with NotI/SfiI sites. This synthetic TTC DNA sequence was inserted at the same sites in vector pMS [53 (link)] to yield final expression plasmids pMS-EGrB(R201K)-TTC and pMS-TTC-MAPTau. The integrity of the vectors was confirmed by DNA sequencing. Human embryonic kidney cells (HEK293T, ATCC, Wesel, Germany, CRL-11268) were cultured under standard conditions RPMI 1640 medium, 10% v/v fetal calf serum (FCS), 100 U/ml penicillin, 100 mg/ml streptomycin, 37°C, 5% CO2). 3x10⁵ HEK 293 T cells per well in a 6-well plate were transfected with the expression vectors (pMS-EGrB(R201K)-TTC and pMS-TTC-MAPTau) using Roti^®Fect (Carl Roth) according to the manufacturer’s instructions. Transfected cells were cultured with 100 ng/ml Zeocin® (Invitrogen, Carlsbad, USA) for selection. The supernatant was collected from the transfected HEK293T cells and the proteins were purified by immobilized metal-ion affinity chromatography (IMAC).

The human translocator
protein TSPO cDNA sequence (NM_009775.4) was fused to the 14 amino
acids V5 tag^{33 (link)} at the 5′ end, separated
from the TSPO coding sequence by a linker sequence (CGTGATCCTCCAGTCGCGACA)
and flanked by AgeI and NotI restriction sites. The DNA sequence was
synthesized by GeneArt Gene synthesis (Thermo Fisher) and cloned in
pHpaI-EGFP AAV vector, a kind gift from McCarty and
Samulski,^{34 (link)} in place of eGFP using AgeI
and NotI sites. The sequence was as follows:
ACCGGTTCTAGAATGGGGAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTGATCCTCCAGTCGCGACAGCCCCGCCCTGGGTGCCCGCCATGGGCTTCACGCTGGCGCCCAGCCTGGGGTGCTTCGTGGGCTCCCGCTTTGTCCACGGCGAGGGTCTCCGCTGGTACGCCGGCCTGCAGAAGCCCTCGTGGCACCCGCCCCACTGGGTGCTGGGCCCTGTCTGGGGCACGCTCTACTCAGCCATGGGGTACGGCTCCTACCTGGTCTGGAAAGAGCTGGGAGGCTTCACAGAGAAGGCTGTGGTTCCCCTGGGCCTCTACACTGGGCAGCTGGCCCTGAACTGGGCATGGCCCCCCATCTTCTTTGGTGCCCGACAAATGGGCTGGGCCTTGGTGGATCTCCTGCTGGTCAGTGGGGCGGCGGCAGCCACTACCGTGGCCTGGTACCAGGTGAGCCCGCTGGCCGCCCGCCTGCTCTACCCCTACCTGGCCTGGCTGGCCTTCACGACCACACTCAACTACTGCGTATGGCGGGACAACCATGGCTGGCGTGGGGGACGGCGGCTGCCAGAGTGAGCGGCCGC.

The envelope selected for VLP generation in this study corresponds to AC10_29 virus, which is a subtype B, fiebig 3, and tier 2 isolate (https://www.hiv.lanl.gov/content/immunology, accessed on 19 March 1998). No sequence modifications were introduced to the AC10 envelope sequence.
HIV-1-Gag VLPs were produced by transient transfection with the FreeStyle 293 Expression System (Invitrogen, Carlsbad, CA, USA) co-transfecting with a pcDNA-dGag plasmid, a furin expression plasmid, and a codon-optimized pcDNA3.1-AC10 envelope expression plasmid provided by GeneArt Gene Synthesis (ThermoFisher Scientific, Waltham, MA, USA). For transfection, 1 μg DNA/10⁶ cells of each dGag, Env, and furin expression plasmids were used at an 11.5:1:0.3 molecular ratio. At 48 h post-transfection, VLPs were harvested by ultracentrifugation. First, VLP supernatants were clarified through two rounds of centrifugation at 800× g for 5 min. Afterwards, the supernatants were ultracentrifuged at 50,000× g for 30 min. Pellets were resuspended in PBS, ultracentrifuged at 160,000× g for 10 min, and resuspended in trehalose (Sigma-Aldrich, St. Louis, MO, USA) 15%/PBS to preserve VLP integrity and stored at room temperature, 4 and −20 °C [6 (link)].

The genes bla_IDC-1 and bla_IDC-2 were synthesized and subcloned into pZE21-MCS1 using KpnI and BamHI restriction sites by GeneArt Gene Synthesis (ThermoFisher Scientific, Regensburg, Germany), as described earlier [97 (link)]. The recombinant plasmids were electroporated into E. coli C600Z1 (Expressys, Bammental, Germany) and selected using the kanamycin resistance of pZE21-MCS1. The same strain with the empty vector was used as negative control.

ChAdOx1 nCoV-19 was produced
as described previously.^{17 (link)} The spike protein
(S) of SARS-Cov-2 (Genbank accession number YP_009724390.1) was codon
optimized for expression in human cell lines and synthesized by GeneArt
Gene Synthesis (Thermo Fisher Scientific). The sequence encoding amino
acids 2–1273 were cloned into a shuttle plasmid following InFusion
cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus
major immediate early promoter (IE CMV) with tetracycline operator
(TetO) sites, a polyadenylation signal from bovine growth hormone
(BGH), and a tPA signal sequence upstream of the inserted gene.