Primestar gxl polymerase

Full-length coding sequences were amplified from SSIII cDNA (Thermo Fisher) using Primestar-GXL polymerase (Takara) and the following primers: fgf20a 5′-AAGCAGGCTCACCATGGGTGCAGTCGGCGA; 5′- GACTGCACCCATGGTGAGCCTGCTTTTTTGTACAAACTTGG; pdgfaa 5′- GCAGATATAAGGTGCGCCAGCGTCACCCA, 5′-CGCGGTTCTCATGGTGAGCCTGCTTTTTTGTACAAACTTGG. Coding sequences were cloned into a hsp70l heatshock misexpression vector from Aman et al., 2018 (link) using NEBuilder HiFi DNA Assembly Master Mix (NEB). Zygotes were injected and raised to 8.5 SSL and given 6 × 1 hr 41°C heatshocks per day for 7 d in a modified Aquaneering rack. Only individuals with epidermal basal cell expression were selected for analysis.

For full-length sequencing of HBV genome, we used the same primers used for PCR in the previously described method^{21 (link),36 (link)}. Briefly, we extracted 100 µL of serum for detection of HBV DNA using SMITEST EX-R&D (Genome Science Laboratories, Fukushima, Japan) and for nested PCR using Prime STAR^®GXL polymerase (Takara Bio Inc., Shiga, Japan) with the primer set WA-L and WA-R and inner primers WA-L2 and WA-R2. For the missing portion of the circular HBV DNA, we performed nested PCR again on the extracted DNA using Prime STAR^®GXL polymerase and the primer sets S1, S2, AS1, and AS2. Final products were sequenced using an Applied Biosystems 3730 x l DNA sequencer (Thermo Fisher Scientific K.K., Kanagawa, Japan) and a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA).

Unique scFv clones were converted into human IgG1 using mixed universal primers with degeneracy [27 (link)]. Individual heavy and light variable chains were amplified using PrimeStar GXL polymerase (Takara Bio). Gel-purified variable chain fragments were cloned into digested vectors using In-fusion HD cloning enzyme mix (Takara Bio). After the converted plasmid was sequenced, sequences verified IgG plasmids were transfected into Expi 293 cells at the 2-mL scale. After culturing for 5 days, cells were removed and antibody-containing supernatant was collected for screening assay.
For milligram-scale antibody purification, Expi293-produced antibodies were purified using CaptivA Protein A affinity resin (Repligen) and eluted with 0.1 M glycine (pH = 2.5) and then neutralized with 1/20 volume 1 M Tris-HCl (pH = 9). Buffer exchange to DPBS was done using Amicon Ultra-15 ultrafiltration units (Mw cutoff = 30 k) (MilliporeSigma).

Gene constructs in this report were amplified by PCR from cDNAs generated by reverse transcription from total RNA, following the procedures in a previous report (Cheung et al., 2008 (link)). Specifically, AtGAP1 and AtYchF1 were amplified using PrimeSTAR GXL polymerase (Cat# R050B, Takara Bio, CA, United States) with the following PCR cycle: 94°C for 5 min; 30 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 1 min 30 s, and a final polymerization step at 72°C for 10 min. PCR products were purified and digested with corresponding restriction enzymes (Supplementary Table S1). For protein expression in bacterial cells, the digested products were purified and ligated with EcoRI-and-SalI double-digested pMAL-C2 vector (New England Biolabs Inc., Beverly, MA, United States), EcoRI-and-SalI double digested pGex-4T-1 vector (GE28-9545-49, GE Healthcare, Chalfont St Giles, England) or AgeI-and-KpnI double-digested pRSETA-HisSUMO vector (an in-house expression plasmid based on pRSET-A [Cat# V35120, Invitrogen, Carlsbad, CA, United States] with an N-terminal His-SUMO tag). All ligated products were transformed into DH5α competent cells and selected on Luria–Bertani (LB) plates containing 100 mg L⁻¹ ampicillin for positive transformants. The positive clones were verified by colony PCR and Sanger sequencing. Detailed primer information for cloning is given in Supplementary Table S1.

HEK293T cells were transfected with 4 μg of pCRT1 or plasmids containing RDRSs using Lipofectamine2000 (Invitrogen). pcDNA3.1 vector (Invitrogen) was used for mock transfection. Culture supernatants were collected 48 hours post-transfection and filtrated through 0.45 μm-pore-size filters and then inoculated into HEK293T cells with 8 μg/ml polybrene (Sigma-Aldrich). After inoculation, supernatants were collected and filtrated every four days. TE671 cells were seeded in 6-well plates at 1 × 10⁶ cells per well one day before infection and diluted supernatants of the inoculated HEK293T cells (36 d.p.i.) were inoculated onto TE671 cells in the presence of 8 μg/ml polybrene. Six hours after inoculation, genomic DNAs were extracted and proviruses were amplified by PCR. PCR was performed with PrimeSTAR GXL polymerase (TaKaRa) and primers listed in Table S1, according to the manufacturer's instructions. The forward primer was designed in the R region of 5′LTR and reverse primer was designed in the U5 region of 3′LTR (positions of primers were indicated in Fig. 7).

Genomic DNA from whole blood or buffy coat was extracted and purified using the QIAamp DNA Blood Maxi and Midi Kits (Qiagen) according to the manufacturer’s instructions. DNA samples from subjects of the discovery cohort were amplified at eight loci (HLA-A, -B, -C, -DRB1, -DQA1, -DQB1, -DPA1 and -DPB1) by full gene-length long-range PCR (Polymerase Chain Reaction). Novel primers for HLA-DQA1, -DPA1 (reverse primer), and -DPB1 (reverse primer) were designed in-house, while a combination of previously described locus-specific primers (Shiina et al., 2012 (link); Hosomichi et al., 2013 (link); Ehrenberg et al., 2017 (link)) was used to amplify the other five genes (Supplementary Table S1). Each locus was amplified in 25 μL reaction volumes consisting of 50–250 ng of gDNA, 1x PrimeSTAR GXL Buffer, 0.625 U PrimeSTAR GXL Polymerase (Takara Bio Inc), 0.2 μM dNTPs and 0.08 mM of the respective forward and reverse primer mix using the PCR cycling conditions described in Supplementary Table S2. To confirm amplification, 2 μL of each PCR product were analyzed on 0.8% agarose gels. The remaining product was purified by the QIAquick PCR Purification Kit (Qiagen) and quantified with a Qubit 4 Fluorometric system (Life Technologies).