Airyscan detector

Catalyzed reporter deposition-FISH (CARD-FISH) analysis was performed as previously described [38 (link)]. Probes used in this study: EUBI-III [39 (link), 40 (link)], NON338 [41 (link)], ARCH915 [42 ], GAM42a with competitor BET42a [43 (link)], Alteromonas - ALT1413 [44 (link)], a combination of Alcanivorax probes: ALV735, ALV735-b and ALV461 [45 (link)], SAR202-312R [46 (link)], and SUP05_1241 [9 (link)]. A mix of ALV735 and ALV735-b probe was used for enumeration of all Alcanivorax, since the probes did not sufficiently discriminate between the different subgroups. ALV461, with a more specific target range, was used for visualization of species affiliated with the A. borkumensis branch of the 16S rRNA gene tree. Two helper probes were designed for ALV735 (CCGCCTTCGCCACTGGTGTTCCT; GCTCCCCACGCTTTCGCACCTCAG) and two helper probes for ALV461 (ATAAGCCTTCCTCCCTACT; CCCACGCTTTCGCACCTCAG). Probes targeting the Alcanivorax genus and their helpers were used with 10% formamide concentration for specific binding at 46 °C. Filters were counted using a Image 2D (Zeiss, Jena, Germany) or Eclipse 50i (Nikon, Tokyo, Japan) microscope. Imaging was done with a laser scanning microscope (LSM780) equipped with an Airyscan detector (Zeiss).

Confocal imaging was performed on a Zeiss Axio Observer.Z1/7 body equipped with a Zeiss Airyscan detector. All channels were collected using Airyscan Multiplex settings with default processing. Cryptococcal India ink and lectin staining images (Fig. 3; Fig. S3) were captured using a Zeiss LD C-Apochromat 60×/1.1 Oil Korr UV VIS IR objective. Correlative DIC images in Fig. S2 were captured shortly after the confocal collection in widefield mode using a Zeiss 40×/1.1 Water corrected Plan Apochromat objective and re-scaled manually to overlay with confocal images taken with the same objective. All other images were captured using a Zeiss Plan-Apochromat 20×/0.8 objective. Live imaging was performed with larvae anesthetized in tricaine as previously described (48 (link)) and simply resting on the bottom of a glass-bottom dish or immobilized in 1% low melt agarose. For the collection of large numbers of events, a combination of widefield and confocal imaging was used to create scout and detail images for later analysis. Widefield imaging was performed using the same Zeiss optical setup, with image capture using a Hamamatsu Flash4.0 V3 sCMOS camera. Widefield fluorescence excitation was generated with a Colibri 7 type RGB-UV fluorescence light source. The filter set was Zeiss set 90 LED.

Eyes of P6 pups were fixed in 4% PFA for 17 minutes at room temperature (rt). After several washes with PBS, dissected retinas were incubated with specific antibodies diluted in blocking buffer (1% FBS, 3% BSA, 0.5% Triton X-100, 0.01% sodium deoxycholate, 0.02% sodium azide in PBS at pH 7.4 [all from Sigma-Aldrich]) at 4°C overnight. The following day, retinas were washed and incubated with IB4 together with the corresponding secondary antibody in PBLEC buffer (1 mM CaCl₂ [Sigma-Aldrich], 1 mM MgCl₂ [PanReac AppliChem], 1 mM MnCl₂ [Sigma-Aldrich] and 0.25% Triton X-100 [Sigma-Aldrich] in PBS) for 1 hour at rt and mounted in fluorescent mounting medium (RotiMount FluorCare; CarlRoth). High-resolution pictures were acquired using Zeiss LSM800 confocal microscope with Airyscan Detector and the Zeiss ZEN software. Quantification of retinal vasculature was done using Fiji.

For this, an inverted LSM880 microscope equipped with an Airyscan detector (Carl Zeiss, Jena) was used with a Plan-Apochromat 63 × 1.4 [numerical aperture (NA)] oil objective with a working distance of 0.19 mm. A 488 nm Argon laser was used for GFP excitation. In confocal mode, emission was recorded with an inbuilt GaAsP detector. For airyscan, the emission was recorded with the in-built 32-element GaAsP detector. For images showing sample change over time, images were only taken around every 50 min to prevent sample photobleaching. In the acquisition of 3D z-series, samples were imaged up to a sample depth of 41 μm, with images of 41 z-planes taken evenly through half of the diameter (dorsoventral) of the nematode. Data was processed using Fiji software (NIH), and the 3D Viewer plugin was used for 3D reconstruction. Brightness and contrast were adjusted equally across the entire image, and where applicable applied equally to controls. Where bright field and fluorescence images were superimposed, brightness and contrast were adjusted separately prior to superimposition.