Nci h1975

This research was approved by the Ethics Committee of The Fourth Hospital of Hebei Medical University. Five pairs of lung cancer tissues and adjacent tissues were derived from patients in the Fourth Hospital of Hebei Medical University with signed informed consent. The tissue samples were preserved at −80°C until subsequent detection. Lung cell lines A549, SK-MES-1, NCI-H1437, and NCI-H1975 were purchased from Procell Life Science&Technology Co., Ltd (Wuhan, China), and NCI-H2170 was purchased from Zhongqiaoxinzhou Biotech Co., Ltd (Shanghai, China). A549 was cultured in Ham’s F-12 K (PM150910, Procell Life Science) with 10% fetal bovine serum (FBS; SH30084.03, Hyclone, USA), while SK-MES-1 was maintained in MEM (41,500–067, Gibco, USA) with 10% FBS. NCI-H1437, NCI-H2170, and NCI-H1975 were grown in RPMI1640 (31,800–014, Gibco) with 10% FBS. All cells were cultured in an incubator (HF-90, Shanghai Lishen, China) of 95% humidity, 5% CO₂ at 37°C.

In this study, all human lung cancer cell lines A549, NCI-H1975, NCI-H292 cells, and the Human Embryonic Kidney 293T cells were purchased from the American Type Culture Collection (ATCC) and were cultured according to the instructions. HEK293T, HEK293T, A-549, and NCI-H292 were cultured using DMEM medium (Gibco, USA) supplemented with 10% fetal bovine serum (Excell), NCI-H1975 cells were cultured with RPMI-1640 (Gibco, USA) supplemented with 10% fetal bovine serum. All cells were maintained at 37°C and 5% CO₂ incubator. To establish stable tumor cells, lentiviruses carrying shRNAs (2 μg DNA) were used to infect the cells in RPMI-1640 (Gibco) supplemented with 10% fetal bovine serum, followed by the standard procedure for Lipofectamine 3000 Transfection Reagent (Thermo Fisher, NY, USA). Finally, the stable cells were selected by 0.5 μg/ml puromycin. For HA-tagged CTSV plasmid construction, 0.5 and 1 μg CTSV plasmid were used and transfected as previously. The knockdown sequence of CTSV is shown as follows: shCTSV#1: TTCCAAAATTTGACCAAAATTTG, shCTSV#3: TCCAAAATTTGACCAAAATTTGG.

This study includes five pairs of lung adenocarcinoma (LUAD) tissues from Space Central Hospital. The ethical approval for this study was from Space Central Hospital (20,200,511-JJJHZ-01). Written informed consents were obtained from each patient. Four NSCLC cell lines (A549, NCI-H1299, HCC827, and NCI-H1975) and human bronchial epithelial cell line HBEC were obtained from Procell Life Science&Technology Co.,Ltd (Wuhan, China). A549 cells were cultured in DMEM (High glucose, Gibco, Grand Island, NY, USA, 11,965–092) with 10% FBS (Gibco) and 1% penicillin/streptomycin (P/S, Procell). NCI-H1299, HCC827, and NCI-H1975 cells were cultured in RPMI-1640 medium (Gibco) with 10% FBS (Gibco) and 1% penicillin/streptomycin (P/S, Procell). HBEC cells were cultured in the bronchial epithelial growth medium (BEGM, Lonza, CC-3170). All the cells were cultured at 37 °C in a 5% CO₂ incubator.

Human LC cell lines (including NCI‐H1975 and A549 cells) and normal human bronchial epithelial cell line 16HBE were procured from the American Type Culture Collection. NCI‐H1975 and A549 were grown in Dulbecco's modified Eagle medium (Gibco, USA) with 10% foetal bovine serum (FBS, Gibco) and 1% penicillin–streptomycin (Solarbio, China) in a cell culture incubator at 37°C with 5% CO₂. Small interfering RNA targeting FBP1 and the relative control (si‐NC) were obtained from RiboBio, and transfection was performed employing Lipofectamine 3000 (Invitrogen) following the manufacturer's instructions.