Takara primescript rt master mix
Takara PrimeScript RT Master Mix is a ready-to-use solution for reverse transcription of RNA into cDNA. It contains all the necessary components for efficient and reliable cDNA synthesis.
Lab products found in correlation
13 protocols using takara primescript rt master mix
Quantifying Gene Expression in MLL-AF9 Mice
Validating Differentially Methylated Genes in AS
Total RNA Extraction and qPCR Analysis
RT-qPCR Analysis of Gene Expression
Quantitative RT-PCR Analysis of MTA1 Expression
Quantitative PCR of AMIGO2 Expression
Quantitative RT-PCR Analysis of mRNA Levels
RT-qPCR Analysis of Gene Expression
Quantitative RT-PCR for Periostin Expression
Periostin forward: TCACATATTCCGCGAGATCA;
reverse: TGCAGCTTCAAGTAGGCTGA;
GAPDH forward: GCACCGTCAAGGCTGAGAAC;
reverse: ATGGTGGTGAAGACGCCAGT.
Quantitative Gene Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!