Log In Sign up
The largest database of trusted experimental protocols

Revertra ace master mix

Manufactured by Toyobo
Visit Supplier
Sourced in Japan

ReverTra Ace Master Mix is a reagent used in molecular biology laboratories. It contains the necessary components for reverse transcription, the process of converting RNA into complementary DNA (cDNA). The mix includes a reverse transcriptase enzyme, necessary buffers, and other essential reagents required for the reverse transcription reaction. The core function of ReverTra Ace Master Mix is to facilitate the conversion of RNA into cDNA, which is a crucial step in various molecular biology techniques, such as gene expression analysis and cDNA library construction.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (6 mentions) Thunderbird sybr qpcr mix, by Toyobo (4 mentions) Power sybr premix extaq, by Takara Bio (3 mentions) Gdna remover, by Toyobo (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Thermal cycler machine, by Takara Bio (2 mentions) Nanodrop, by Thermo Fisher Scientific (2 mentions) M mlv reverse transcriptase kit, by Toyobo (1 mentions) Sybr green pcr kit, by Toyobo (1 mentions) Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions) Reliaprep rna miniprep system, by Promega (1 mentions) Sybr green probe sets, by Thermo Fisher Scientific (1 mentions) Stepone plus thermal cycler, by Thermo Fisher Scientific (1 mentions) Thunderbird sybr mix, by Toyobo (1 mentions) Nucleospin rna, by Macherey-Nagel (1 mentions) Lightcycler system, by Roche (1 mentions) Thermal cycler system, by Bio-Rad (1 mentions) Software, by Syngene (1 mentions) Genegenius super 12, by Syngene (1 mentions)

14 protocols using revertra ace master mix

1

Overexpression and Knockdown of EPB41L4A-AS1 in Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
HTR8 cells were donated by Prof. Haixiang Sun (Nanjing Drum Tower Hospital), and BeWo and JEG3 cells were purchased from the ATCC. Cells were cultured in RPMI 1640 medium (containing 10% FBS, 10 units/mL penicillin, and 10 mg/mL streptomycin) in 5% CO2 at 37°C. For EPB41L4A-AS1 gene overexpression or knockdown, 1 μg plasmids or 50 nM siRNA were transfected using Lipofectamine 3000 (Invitrogen, 1656200) as described by the manufacturer.
A total of 500 ng RNA was subjected to reverse transcription using the M-MLV reverse transcriptase kit (Toyobo, Japan) for cDNA synthesis. Gene reverse transcription used ReverTra Ace Master Mix (Toyobo, FSQ-301), and mRNA expression was tested using an ABI7500 cycler (USA) with the SYBR Green PCR kit (Toyobo, Hilden, Japan) and normalizing to β-actin mRNA. All primer sequences are listed in Table S1. All PCRs were performed in triplicate.
Zhu Y., Liu Q., Liao M., Diao L., Wu T., Liao W., Wang Z., Li B., Zhang S., Wang S., Xie W., Jiang Y., Xu N., Zeng Y., Yang B.B, & Zhang Y. (2019). Overexpression of lncRNA EPB41L4A-AS1 Induces Metabolic Reprogramming in Trophoblast Cells and Placenta Tissue of Miscarriage. Molecular Therapy. Nucleic Acids, 18, 518-532.
+ Open protocol
+ Expand
2

Quantitative Real-Time RT-PCR Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted using a ReliaPrep RNA Miniprep System (Promega) as per the manufacturer’s instructions. cDNA was synthesized from the extracted RNA by using ReverTra Ace Master Mix with gDNA Remover (TOYOBO, Japan). Real-time RT-qPCR was performed using SYBR Green probe sets (Applied Biosystems, USA) and a Step One Plus thermal cycler (Applied Biosystems), and a standard curve was prepared for each target. RPLP0, which encodes a ribosomal protein, was used as the internal control in all assay. The primer sets used in this study are listed in Supplementary Table S4.
Sasaki-Honda M., Jonouchi T., Arai M., Hotta A., Mitsuhashi S., Nishino I., Matsuda R, & Sakurai H. (2018). A patient-derived iPSC model revealed oxidative stress increases facioscapulohumeral muscular dystrophy-causative DUX4. Human Molecular Genetics, 27(23), 4024-4035.
+ Open protocol
+ Expand
3

Zebrafish CRISPR Targeting of lztr1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA extraction from zebrafish was performed using NucleoSpin RNA (Macherey‐Nagel). cDNA was synthesized using ReverTra Ace Master Mix (Toyobo). Primers flanking the CRISPR‐targeted lztr1 exon (5'‐TAACACTCAACTTCGGGCCT‐3' and 5'‐TAGTAAACGCCCGACACCAT‐3') and primers located upstream of the lztr1 deletion site (5'‐TAACACTCAACTTCGGGCCT‐3' and 5'‐GGTATGCTTGCTACGCCTTG‐3') were used for the sequencing and quantitative PCR analyses, respectively. Quantitative PCR was performed using THUNDERBIRD SYBR Mix (Toyobo) and analyzed with the LightCycler System (Roche Diagnostics). Values were normalized to gapdh expression (5'‐GTGGAGTCTACTGGTGTCTTC‐3' and 5'‐GTGCAGGAGGCATTGCTTACA‐3').
Nakagama Y., Takeda N., Ogawa S., Takeda H., Furutani Y., Nakanishi T., Sato T., Hirata Y., Oka A, & Inuzuka R. (2019). Noonan syndrome‐associated biallelic LZTR1 mutations cause cardiac hypertrophy and vascular malformations in zebrafish. Molecular Genetics & Genomic Medicine, 8(3), e1107.
+ Open protocol
+ Expand
4

Quantitative RT-PCR Analysis of Nrf2 Pathway

Check if the same lab product or an alternative is used in the 5 most similar protocols
RT-PCR was used to analyze the levels of Nrf2, NQO-1, HO-1, CAT, and GAPDH mRNA. GAPDH was used as an internal standard. Total RNA was isolated from 5 × 106 PC12 cells in the logarithmic phase using RNAiso Plus (Takara, Shiga, Japan) according to the manufacturer’s instructions. Reverse transcription was done using ReverTra Ace Master Mix from Toyobo (Osaka, Japan) following the manufacturer’s instructions. Semiquantitative RT-PCR was performed with a thermal cycler system (Bio-Rad) using PrimeSTAR GXL DNA polymerase (Takara, Shiga, Japan). The primers used for PCR are listed in Table 1. The RT-PCR products were separated on 2% agarose gel, and the intensity of each band was quantified using SynGene software (SynGene, Cambridge, UK) and expressed in arbitrary units (GeneGenius Super 12, Syngene, Cambridge, UK).
Terada K., Murata A., Toki E., Goto S., Yamakawa H., Setoguchi S., Watase D., Koga M., Takata J., Matsunaga K, & Karube Y. (2020). Atypical Antipsychotic Drug Ziprasidone Protects against Rotenone-Induced Neurotoxicity: An In Vitro Study. Molecules, 25(18), 4206.
+ Open protocol
+ Expand
5

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from 3T3-L1 cells and mouse fat tissue using an RNeasy mini kit (Qiagen, Hilden, Germany) and TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. First-strand complementary DNA was synthesized from 0.5 μg of extracted total RNA using ReverTra Ace Master Mix (TOYOBO, Osaka, Japan). The RT-PCR was performed in a mixture containing Power SYBR Premix ExTaq (RP041A; Takara, Shiga, Japan), primers, and cDNA using a Thermal Cycler Dice instrument (Takara). Gene expression was normalized by housekeeping gene 36B4. The sequences of primers used are described by Song et al. [19 (link)]. Primers are specified in Supplementary Table S1.
Won S.M., Chen S., Lee S.Y., Lee K.E., Park K.W, & Yoon J.H. (2020). Lactobacillus sakei ADM14 Induces Anti-Obesity Effects and Changes in Gut Microbiome in High-Fat Diet-Induced Obese Mice. Nutrients, 12(12), 3703.
+ Open protocol
+ Expand
6

Lacrimal Gland and Conjunctiva Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from the lacrimal gland or conjunctiva of mice by using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Complementary DNA was produced from total RNA using RevertraAce Master Mix (Toyobo, Osaka, Japan). Quantitative real-time (qRT-)PCR was performed using the StepOne-Plus Real Time PCR system (Applied Biosystems, Foster City, CA, USA) with Fast Advanced Master Mix (Applied Biosystems) and using the predesigned primers for mucin5AC (MUC5AC), fatty acid synthase (FASN), low density lipoprotein receptor (LDLR), uncoupling protein-1 (UCP-1) and beta-actin [TaqMan Gene Expression Assay (MUC5AC: Mm01276718-m1,FASN: Mm00662319_m1, LDLR: Mm01177349_m1,UCP-1: Mm01244861_m1 and beta-actin: Mm00607939-s1)]. The mRNA levels were evaluated by the ΔΔCT method, and normalized to beta-actin mRNA.
Inaba T., Tanaka Y., Tamaki S., Ito T., Ntambi J.M, & Tsubota K. (2018). Compensatory increases in tear volume and mucin levels associated with meibomian gland dysfunction caused by stearoyl-CoA desaturase-1 deficiency. Scientific Reports, 8, 3358.
+ Open protocol
+ Expand
7

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from epididymal fat tissue and liver using an RNeasy Mini Kit (Qiagen, Hilden, Germany) and TRIzol (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s protocol. First-strand complementary DNA was synthesized using a Veriti™ 96-Well thermal cycler machine (Thermo Scientific, Waltham, MA, United States) by mixing the extracted total RNA and ReverTra Ace Master Mix (Toyobo, Osaka, Japan). A mixture of Power SYBR Premix ExTaq (RP041A; Takara, Shiga, Japan), primers and cDNA was used for amplification using a thermal cycler machine (Takara). Gene expression was normalized by a housekeeping gene, 36B4. The primer sequences for the genes are shown in Supplementary Table S2.
Won S.M., Seo M.J., Kwon M.J., Park K.W, & Yoon J.H. (2021). Oral Administration of Latilactobacillus sakei ADM14 Improves Lipid Metabolism and Fecal Microbiota Profile Associated With Metabolic Dysfunction in a High-Fat Diet Mouse Model. Frontiers in Microbiology, 12, 746601.
+ Open protocol
+ Expand
8

RNA Extraction and qRT-PCR for C3H10T1/2 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from C3H10T1/2 cells using QIAzol lysis reagent (QIAGEN, Germantown, MD, USA). First-strand complementary DNA was synthesized from 0.5 μg of total RNA using ReverTra Ace Master Mix (Toyobo, Osaka, Japan) according to the manufacturer’s instructions. Quantitative RT PCR was performed in 25 μL final reaction volume containing Power SYBR Premix ExTaq (RP041A; Takara, Shiga, Japan), primers, and cDNA using thermal cycler machine (Takara). The primer sequences used for the PCR were described previously24 (link).
Seo M.J., Won S.M., Kwon M.J., Song J.H., Lee E.B., Cho J.H., Park K.W, & Yoon J.H. (2023). Screening of lactic acid bacteria with anti-adipogenic effect and potential probiotic properties from grains. Scientific Reports, 13, 11022.
+ Open protocol
+ Expand
9

Tissue RNA Extraction and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total cellular RNA was prepared using the Tissue Total RNA Mini Kit (FAVORGEN), and cDNA was synthesized using ReverTra Ace Master Mix (TOYOBO). Expression of target genes was analyzed using THUNDERBIRD SYBR qPCR Mix (TOYOBO) on a CFX Connect Real Time System (Bio-Rad). The qPCR data were acquired on CFX Maestro (Bio-Rad). Primers are listed in Supplementary Table 10. GAPDH was used as a reference. Primers were purchased from INTEGRATED DNA TECHNOLOGIES or FASMAC.
Takase S., Hiroyama T., Shirai F., Maemoto Y., Nakata A., Arata M., Matsuoka S., Sonoda T., Niwa H., Sato S., Umehara T., Shirouzu M., Nishigaya Y., Sumiya T., Hashimoto N., Namie R., Usui M., Ohishi T., Ohba S.I., Kawada M., Hayashi Y., Harada H., Yamaguchi T., Shinkai Y., Nakamura Y., Yoshida M, & Ito A. (2023). A specific G9a inhibitor unveils BGLT3 lncRNA as a universal mediator of chemically induced fetal globin gene expression. Nature Communications, 14, 23.
+ Open protocol
+ Expand
10

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
RNA was isolated using TRIzol reagent (Life Technologies). cDNA was synthesized using the ReverTra Ace master mix (Toyobo, Osaka, Japan). qPCR analysis was performed using the Thunderbird SYBR qPCR mix (Toyobo) according to the manufacturer’s instructions. Gene amplification was performed using a StepOnePlus qPCR kit (Thermo Fisher Scientific). The primer sequences used in this analysis are listed in Supplementary Table 1.
Torizal F.G., Utami T., Lau Q.Y., Inamura K., Nishikawa M, & Sakai Y. (2022). Dialysis based-culture medium conditioning improved the generation of human induced pluripotent stem cell derived-liver organoid in a high cell density. Scientific Reports, 12, 20774.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!