Abi 3100 dna sequencer

Based on FTIR analysis, bacteria that expressed high BNC level was selected and identified by amplification and sequencing of the 16S rDNA. Bacterial cells collected from overnight HS culture were used for DNA isolation⁴⁸ . The PCR reaction was carried out using the universal 16S rRNA primers 27F: 5′-AGA GTT TGA TCM TGG CTC AG-3′ and 1492R: 5′-CGG TTA CCT TGT TAC GAC TT-3′. The amplification was done as follows: initial denaturation at 95 °C for 5 min followed by 35 cycles of 94 °C, 55 °C and 72 °C for one minute each, and a final extension at 72 °C for 10 min. The PCR product was analyzed on 1% agarose gel-electrophoresis, purified and sequenced by Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) using ABI 3100 DNA Sequencer. The nucleotide sequence was compared with those available sequences on the National Center for Biotechnology Information GenBank (NCBI GenBank) Database employing BLASTn through the Basic Local Alignment Search Tool (BLAST). The phylogenetic tree was constructed adopting the Neighbor-Joining tree method using Molecular Evolutionary Genetics Analysis (MEGA-X) and edited by iTOL v5, Interactive Tree Of Life an online tool for the display, annotation, and management of phylogenetic trees.

The presence of resistant genes (listed below) were investigated by PCR assays as previously reported [16 (link)]. PCR was conducted in a GeneAmp 9700 (Perkin-Elmer, Illinois, USA) system using the conditions specified for each primer; corresponding to the source references. The resistant genes investigated were bla_TEM-1, bla_SHV, bla_CTX-M-like, bla_NDM, bla_OXA-1, qnrA, qnrB, qnrS, aac(6′)-Ib Ib-cr, gyrA, parC, gyrB, parE, intI1, intI2, bla_KPC, bla_VIM, bla_IMP, bla_OXA-48, and ampC. The detection of bla_PER, bla_GES and bla_VEB was performed by PCR according to Opazo et al. [17 (link)].
Isolates resistant to ciprofloxacin and for which the ceftaxidime or cefotaxime MICs were >8 mg/L were screened for ESBLs and qnr genes. Double disc and combination disc tests were used for ESBLs confirmation.
Amplified PCR products were purified with Qiagen purification kit (Qiagen, Limburg Netherlands) according to the manufacturer's instructions and both strands were sequenced by automated ABI3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA). The BLAST program of the National Centre for Biotechnology Information (http://www.ncbi.nlm.nih.gov) was used to search and compare databases for similar nucleotide sequences.

Till date lumpfish genome has not been sequenced and also the nucleotide sequences of the selected proteins are not available in the databases. Therefore, degenerate primers were designed using geneious9 software (Biomatters, New Zealand) and restriction sites (GCTGGCGCCTCTCTAGACACAGGATCC for forward and GTCGACAAGGGTACCATAGAAGGGAGAAGC for reverse) were added to each primer. PCR amplification for degenerate primers were performed under the following conditions: initial denaturation at 94 °C for 2 min, followed by 34 cycles of 94 °C for 30 s, 50 °C for 30 s, 72 °C for 2 min, and final extension at 72 °C for 2 min. The PCR products were ran on 1% agarose gel. Expected bands from the gel were excised and DNA was purified using NucleoSpin^® Gel and PCR Clean-up (Macherey-Nagel, Germany). Purity and concentration of gel purified DNA was analysed by Nanodrop 1000, (ThermoFisher Scientific, USA). Further, the purified DNA was sequenced using ABI 3100 DNA sequencer, (Applied Biosystems, USA) using Big dye termination chemistry (ThermoFisher Scientific, USA). Sequences obtained from the DNA sequencer were used for real time primer designing. The oligonucleotide sequences and specifications are mentioned in Table 1. All primers used for real time analysis were sequenced and blasted against NCBI to confirm their identification.

Total RNA was isolated from explant-derived cultures from HME patients and controls using Trizol standard procedures. To synthesize cDNA, 5 µg total RNA was reverse transcribed using the random primers (TaKara Biotechnology, Dalian, China) and EasyScript ReverseTranscriptase (TransGen Biotech, Beijing, China). The cDNA products were used directly as templates for PCR amplification. The primers used for the EXT2 human cDNA were: forward: 5′-GGGAGTATAATGAACTGCTCA-3′; reverse: 5′-GCTCCACGAAGAACCACA-3′. The expected sizes of the EXT2 mRNA and cDNA were 3651 and 589 bp respectively. The PCR products were resolved by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining (Sigma-Aldrich, Beijing, China). The nucleotide sequences were determined by direct sequencing of the PCR products (ABI 3100 DNA sequencer, Applied Biosystems).
The repeated PCR products were cloned into the PMD-18-T vector (TaKaRa Biotechnology, Dalian, China) and amplified in the E. coli TOP10 reference strain. Clones were picked up through blue-white spot screening on AMP/IPTG/X-Gal L-agar plates. After plasmid extraction, sequencing of the clones was conducted to evaluate the percentage of alternative transcripts that was present.