Rt pcr kit

Total RNA was extracted as described above. qPCR was performed using a Qiagen RT‐PCR kit with SYBR Green and specific primers. GAPDH‐specific primer served as internal controls. qPCR primer sequences were as follows: Mouse SGK1 forward primer CTGCTCGAAGCACCCTTACC; reverse primer TCCTGAGGATGGGACATTTTCA. Mouse CEP55 forward primer CCTAGTAGCTCCAAGTCAGACA; reverse primer ACCTTAGGTGGTCTTTGAGTCTC. Mouse ACSL1 forward primer TGCCAGAGCTGATTGACATTC; reverse primer GGCATACCAGAAGGTGGTGAG. Mouse MGP forward primer GGCAACCCTGTGCTACGAAT; reverse primer CCTGGACTCTCTTTTGGGCTTTA. Mouse OLFM4 forward primer ACGGTCCGAGTAGAGGTCAT; reverse primer CCATGACTACAGCTTCCAGGAG. Mouse DPP10 forward primer CGAGGAAGTGTGAGCTCCG; reverse primer TACTTCCTAGTTCCTGGTCGG. GAPDH forward primer AAATGGTGAAGGTCGGTGTGAAC; reverse primer CAACAATCTCCACTTTGCCACTG.

Bacterial cells were grown to midlog phase in M9 MSM, with or without supplementation with 0.0075 mg/l ciprofloxacin. RNA was isolated by the RNeasy kit (Qiagen, Germany). The concentration and purity of the extracted RNA were checked by a nanophotometer (P330 nanophotometer Implen, Germany).
Qiagen RT PCR kit was used for first cDNA, and a Quantitect SYBR Green PCR kit (Qiagen, Germany) was used for Real-time PCR. Equal aliquots of cDNA derived from RNA samples were used as templates in the amplification reactions. The housekeeping gene ihfB [49 (link)] was chosen as the control for the normalization of cDNA loading in each PCR. An aliquot of 1 µg of DNase-treated RNA was added in each reaction as a non-reverse transcribed control. Reactions were performed in Rotor-Gene Q (Qiagen, Malaysia), and the fold change in the levels of the transcripts was determined by the ∆∆Ct method [50 (link)].

Total RNA was prepared from 1 × 10⁴ to 2 × 10⁴ cells of each individual subset, sorted directly into RLT lysing buffer using a QIAGEN RNeasy mini-kit. RNA was used to synthesize cDNA using the QIAGEN RT-PCR Kit and the manufacturer’s recommended protocol under the following conditions: 95°C denaturation for 2 min; 30 cycles of 94°C for 1 min, 60°C for 1 min, and 72°C for 1 min; and a final 72°C extension for 10 min. The reaction buffer contained 100 mM Tris-HCl, pH 8.8, 15 mM MgCl₂, and 750 mM KCl. Primers used were TCRB13-1 (5’- tgctggcaaccttcgaatagga-3’) and TCRBC1 (5’- tgagaaatgtgactccaccca-3’). PCR products were cloned (TOPO-TA Cloning Kit; Invitrogen) and sequenced using the primer TCRB13-1 on an ABI 3730 sequencer.

In order to validate data obtained through NGS, we designed species-specific PCR primers to 1) confirm the presence of our target of interest in individual DBS, and 2) determine the prevalence of the detected pathogens from our samples. Primers were designed using the Primer3 software version 2.3.4 in Geneious (S1 Table) [40 (link)]. The presence of GBV-C was determined from individual DBS using a one-step reverse transcription polymerase chain reaction (RT-PCR) kit (Qiagen, Germany). The sequencing reaction was run on a 1% agarose gel to visualize the amplified product. Samples that produced visible bands were sent for Sanger sequencing using the forward primer at Quintarabio labs (USA). Chromatogram files were then aligned to the reference genome in Geneious 10.2.2 to confirm specificity. The presence of HBV was determined from individual DBS using the iTaq Universal One-Step RT-qPCR Kit (Bio-Rad, USA) containing SYBR green on a real-time PCR platform. Positive samples were sequenced and confirmation analysis was performed as stated above.

Single-strand cDNA was synthesized with an RT-PCR kit (Qiagen) according to the manufacturer’s instructions. Reverse transcription was performed using the RNA polymerase chain reaction (PCR) core kit (Applied Biosystems). Quantitative real-time PCR used SYBR green technology (Applied biosystems) on cDNA generated from the reverse transcription of purified RNA. After preamplification (95°C for 2 min), the PCRs were amplified for 40 cycles (95°C for 15s and 60°C for 60s) in a sequence detection system (PE Prism 7000; Perkin-Elmer Applied Biosystems). The exponential phase, linear phase and plateau phase of PCR amplification were carefully monitored to ensure a measurement of real time transcription (33). mRNA expression was normalized against GAPDH expression using the standard curve method.
PD-1-FW, 5-CCGCCTTCTGTAATGGTTTGA-3;
PD-1-RV, 5-GGGCAGCTGTATGATCTGGAA-3;
Tbet-FW, 5-GATCGTCCTGCAGTCTCTCC-3;
Tbet-RW, 5-AACTGTGTTCCCGAGGT GTC-3;
GAPDH-FW, 5-CAACAGCAACTCCCACTCTTC-3;
GAPDH- RW, 5- GGTCCAGGGTT TCTTACTCCTT-3

Specialist nurses collected the specimens in our hospital. The length of the throat swab was extended from the earlobe to the tip of the nose. The specimens were collected in normal saline and stored at -80 °C. Frozen nasopharyngeal swab samples were taken and naturally thawed at room temperature. Two hundred microliters of the sample was extracted, and ADV-DNA replication was detected by using a RT‒PCR kit (Qiagen, USA). According to the kit's instructions, the bronchoalveolar lavage fluid (BALF) sample was used for the DNA extraction. Commercial primers and probes were utilized for PCR amplification. Furthermore, ADV DNA > 1.0 × 10³ copies/mL was considered to be a positive result.