Quantitect sybr green pcr

The mRNA expression levels of TNF-α, IL-8, IL-6, IL-1β, TLR4 and β-actin were quantified by real-time PCR using an iCycler iQ
(Bio-Rad Laboratories, Tokyo, Japan) and a commercial kit (QuantiTect^TM SYBR Green PCR; QIAGEN, Hilden, Germany).
The primers for real-time PCR were designed based on the respective bovine sequences by using the Primer-3 software. The
primers were 5′ TGGAGGGAGAAGGGATTCTT 3′ (forward) and 5′ CCAGGAACTCGCTGAAACTC 3′ (reverse) for TNF-α,
5′–ATGACTTCCAAGCTGGCTGTTG–3′ (forward) and 5′–TTTCATGGATCTTGCTTCTCAGC–3′ (reverse) for IL-8, 5′–ATGACTTCTGCTTTCCCTACCC–3′
(forward) and 5′–GCTGCTTTCACACTCATCATTC–3′ (reverse) for IL-6, 5′–ATGAAGAGCTGCATCCAACA–3′ (forward) and
5′–ATGGAAGACATGTGCGTAGG–3′ (reverse) for IL-1β, 5′–CTTGCGTACAGGTTGTTCCTAA–3′ (forward) and 5′–CTGGGAAGCTGGAGAAGTTATG–3′
(reverse) for TLR4 and 5′–CCAAGGCCAACCGTGAGAAGAT–3′ (forward) and 5′–CCACGTTCCGTGAGGATCTTCA–3′ (reverse) for
β-actin. The amplification program consisted of a 15-min denaturation at 95 C followed by 40 cycles of
amplification (94 C for 15 sec, 56–60 C for 30 sec and 72 C for 20 sec). To quantify the expression of the target genes, a
series of standards was generated by amplifying a fragment of DNA that contained the target sequence for real-time PCR
(100–250 bp). The values were normalized to β-actin as an internal standard.

ICR mice were orally administered with alprazolam or LE for 21 days, and total RNA was extracted from brain cortex tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Real-time quantitative PCR was performed using the SYBR Green^TM kit (Quantitect^TM SYBR Green PCR, Qiagen, Hilden, Germany), and the relative gene expression was calculated using the Ct method (Livak and Schmittgen 2001 (link)). The primer types and sequence information used are as follows: GABA_A receptor (NM 008073.3; F: GCTTTGGTGGAGTATGGCAC, R: GGCCTTGAAGGAAAACATCCG), GABA_B receptor (NM 019439.3; F: TCCGGAACGGGGAAAGAATG, R: TTGTACTCGCCGACCTTCAC) and 5HT_1A receptor (NM 008314.2; F: CCGATCTCATGGTGTCAGTG, R: ACATCCAGGGCGATAAACAG).
The GABA content in the brain was analysed by high-performance liquid chromatography (HPLC) as previously described, with some modifications, using a Waters AccQ-Tag column (3.9 × 150 mm²; Milford, MA, USA) at 250 nm excitation/395 nm emission wavelengths (Waters 2475 Multi λ Fluorescence Detector) (Jo et al. 2021b (link)). Mobile phases A, B and C were water AccQ-tag Eluent A (acetate–phosphate buffer), acetonitrile and Milli-Q water, respectively.

Total RNA was isolated from the 3T3-L1 cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacture’s recommendations. Real-time quantitative polymerase chain reaction (PCR) was performed with an SYBR Green^TM kit (Quantitect^TM SYBR Green PCR; QIAGEN, Valencia, CA, USA). The cycling conditions were 15 minutes at 95°C, 40 cycles of 15 seconds at 94°C, 30 seconds at 51°C, and 30 seconds at 72°C. Relative quantification was performed using the Delta-Delta method.11 (link) The primer sequences of the genes examined are shown in Table 1.