Expand long range dntpack

Green fluorescent protein (GFP) and mCherry tagging vectors were constructed using
double-joint polymerase chain reaction (DJ-PCR; Hammond et al. 2011b (link); Samarajeewa et al. 2014 (link)). For strain confirmation, genomic DNA
was isolated from conidia (Henderson et
al. 2005) or vegetative hyphae (Qiagen DNeasy Plant Mini Kit).
PCR-based validation of genotypes was conducted using the Promega GoTaq Green Master Mix
or the Roche Expand Long Range dNTPack. When necessary, DNA sequencing was conducted by
the University of Missouri (MU) DNA Core. Primers for strain construction and confirmation
are listed in Supplementary Table S1.

Genomic DNA was extracted from the leaves of two-week-old plants using a NucleoSpin Plant II Kit (MACHEREY-NAGEL, Dueren, Germany) according to the manufacturer´s instructions. DNA amplification was performed using a C1000 Touch Thermal Cycler (Bio-Rad, Hercules, CA, USA) with the primers and PCR conditions listed in Supplementary Table S9. Primers reported by Fu et al., Yan et al. and Milec et al. [12 (link),15 (link),19 (link)] were used for VRN1 genotyping. The Ppd-A1 allele was determined following [61 (link)], and the Ppd-D1 allele was determined following [2 (link)]. New primers for VRN1 sequencing were designed using Primer3 2.3.7 [62 (link)] as part of Geneious Prime^® 2021.2.2 (https://www.geneious.com). To sequence all three homoeologous VRN1 loci, several overlapping regions were amplified (Supplementary Figure S7). Long amplicons (from 6 to 11 kb) were amplified by PrimeSTAR GXL DNA Polymerase (Takara Bio, Kusatsu, Japan) and Expand Long Range, dNTPack (Roche, Basel, Switzerland), and short amplicons (from 600 bp to 3 kb) were amplified by HOT FIREPol DNA Polymerase (Solis BioDyne, Tartu, Estonia), all according to the manufacturer’s instructions. The specificity of all primer pairs was tested on DNA from nulli-tetrasomic lines of cv. Chinese Spring (N5AT5B, N5AT5D, N5BT5A, N5BT5D, N5DT5A and N5DT5B).

Genomic DNA for GAA expansion analyses was extracted from fibroblasts and iPSCs using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer's instructions. The concentration and purity of the genomic DNA were assessed using a Nanodrop1000 spectrophotometer (Thermo Fisher Scientific). The size of the GAA expansion in intron 1 of the FXN gene was determined by PCR using the Expand Long Range dNTPack (Roche, Australia) as recommended with 20 ng template DNA, 0.4 μM of EXP-Bam-F 5′AAGGAAGTGGTAGAGGGTGTTTCACGAGGA3′ and EXP-Bam-R 5′TTTGGATCCAACTCTGCTGACAACCCATGCTGTCCACA3′ primers and 1x Q solution (QIAGEN, Australia). PCR products were electrophoresed on a 1% (w/v) agarose, 1x TAE gel alongside standard DNA markers (200 bp ladder, Promega). Size determination was performed using GeneTools software from SynGene, Synoptics (In Vitro Technologies). The positive control (BAC clone RP11-265B8) and non-expanded alleles in the normal range yielded an 810 bp fragment. The hESC H9, BG01V (ATCC) and the human fibroblast feeders WS1 (ATCC) were included as negative controls for FXN expansion.