Sybr green 1 supermix
SYBR Green I Supermix is a ready-to-use solution designed for real-time PCR applications. It contains SYBR Green I dye, which binds to double-stranded DNA and emits a fluorescent signal upon excitation, enabling the detection and quantification of DNA amplification during the PCR process.
Lab products found in correlation
6 protocols using sybr green 1 supermix
Quantitative Real-Time PCR Analysis of Tight Junction Protein Expression
Tibia Growth Plate Gene Expression
Quantification of Denitrification Genes by qPCR
Quantitative RT-PCR for Gene Expression
Real-Time PCR Analysis of Gene Expression
Reverse
GACTCAACACGGGAAACCTC
RNA Isolation and Real-Time PCR Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!