Sybr green 1 supermix

Total RNA was prepared from MDA-MB-231 or MCF7 cells by using TRIzol reagent (Invitrogen). First-strand cDNA was synthesized from 1 μg total RNA in 20 μl reaction volume with SuperScript (Invitrogen) according to manufacturer’s instructions. qRT-PCR analysis with SYBR Green I supermix (Bio-Rad) was performed on the iQ5 cycler (Bio-Rad). The specific primer sets were as follows: GADPH, 5′-GAAGGTGAAGGTCGGAGTC-3′ and 5′-GAAGATGGTGATGGGATTTC-3′; BIM, 5′-ATGGCAAAGCAACCTTCTGA-3′ and 5′-GGATTACCTTGTGGCTCTGTCT-3′; BCL2, 5′-GCCCTGTGGATGACTGAGTA-3′ and 5′-CATCACCAAGTGCACCTACC-3′; BCL6, 5′-ATGTACCTGCAGATGGAGCA-3′ and 5′-ATCTCTGCTTCACTGGCCTT-3′; BCL-xl 5′-GGATGGCCACTTACCTGAAT-3′. and 5′-CTGCTGCATTGTTCCCATAG-3′; FOXO1, 5′-GGTCAAGAGCGTGCCCTACT-3′ and 5′-GCTCTTGCCACCCTCTGGAT-3′. 1 μl cDNA as template was in 20 μl reaction volume. The relative expression levels were calculated using the comparative cycle threshold (CT) method (2^−ΔCT) [41 (link)] by the CFX Manager software (Bio-Rad).

The cDNA were amplified by real-time PCR using SYBR^® Green I (BIORAD, Gladesville, NSW, Australia) on the BIORAD MyiQ^TM Single-Colour Real-Time PCR Detection System (BIORAD, Gladesville, NSW, Australia) following the manufacturer’s instructions. Each PCR reaction contained 2 μL of cDNA mixed with 1–3 μL of each primer (volume fluctuates depending on the optimized primer concentrations as shown in Table 2), 12.5 μL of SYBR^® Green I Supermix (BIORAD, Gladesville, NSW, Australia) and RNase free water (Invitrogen, San Diego, CA, USA) to make up a final volume of 25 μL. The thermo cycle protocol consisted of initial hot start at 95 °C for 3 min as the initial denaturation step of one cycle, followed by 40 cycles at 95 °C for 10 s (denaturation), 51.0 to 61.2 °C for 45 s (annealing) and an extension step at 95.0 °C for 1 min. Optimized annealing temperatures for each gene are specified in Table 2. PCR runs for each sample were performed in triplicate. The CT values for each target gene were normalized with the reference gene (R18s) for both test and the control groups. The mean ΔCT value was used in the ΔCT method to calculate the relative expression values for the test and the control groups. The fold change in each target gene mRNA level in the lecithin diet was calculated relative to the control diet which was set to 1.
Reverse
GACTCAACACGGGAAACCTC

RNA was isolated by TRIzol according to the manufacturer’s instructions (Thermo-Fisher Scientific, Roskilde, Denmark). The first strand complementary DNA was synthesized from 1 µg total RNA by Revert aid cDNA kit (Sigma, Copenhagen, Denmark). The PCR products were visualized in real-time using SYBR Green I Supermix (Bio-Rad) and an iCycle instrument (Bio-Rad) using standard curve protocols, normalized to the geometric mean of the reference genes. The quantitative data presented is an average of duplicate or triplicate per independent experiment. Primer sequences for the genes tested are shown in Supplementary Table 3.