In fusion pcr cloning system

In-frame deletions of pucBAa and pucBAd were created by PCR using the Phusion high-fidelity DNA polymerase (New England Biolabs) to amplify 1 kb of DNA upstream of the second codon in the coding region for each of these genes and 1 kb of DNA downstream of the stop codon for each of these genes. These fragments were then incorporated into PstI-digested (pucBAa) or NotI/PstI-digested (pucBAd) pJQ200SK suicide vector (28 (link)) using the in-Fusion PCR cloning system (Clontech). All plasmids were mobilized into R. palustris by conjugation with E. coli S17-1, and double-crossover events for deletions or allelic exchange were achieved using a previously described selection and screening strategy (29 (link)). All deletions were verified using PCR.

The full-length cDNA of SiYGL2, excluding the stop code, was amplified from Yugu1 using the following primers: 5′TATCTCTAGAGGATCCCTATCCTCCTTCGGTCCTTCCCATT 3′ and 5′ TGCTCACCATGGATCCGAACGAAGTAACAAGCCCTACACCT 3′ [the underlined sequences are adaptors for In-fusion^® PCR cloning system (Cat no. 072012, Clontech, United States) and contain BamHI cleavage sites]. The cDNA sequences were cloned into the p16318hGFP vector to form fusion proteins with the C-terminus of GFP. These vectors were then transfected into foxtail millet protoplasts by PEG-mediated transformation and detected by confocal microscopy (LSM700, Carl Zeiss, Germany).

Human TFPI promoter Firefly-luciferase reporter (TFPI-Luc), a pGL3-Basic vector containing a fragment of TFPI promoter from -1224 to +45, was previously described [37 (link)]. SERPINE1 promoter (-483/+75) [38 (link)] was PCR amplified from THP1 genomic DNA then inserted in place of the CMV promoter in the pd4EGFP plasmid (Clontech) that contains the sequence coding for a destabilized version of EGFP. The resulting vector was named SERPINE1-dEGFP. GFP-tagged MAST2 expression vector (RG206492 form Origene) was used as template to PCR amplify only the full-length coding sequence of MAST2 (without the GFP coding sequence), which was then cloned into pCDNA3 vector using the In-Fusion PCR cloning system (Clontech).

To investigate the transcriptional activity of ScDREB10, the yeast two-hybrid system (Y2H) with pGBKT7 vector and Y2H yeast strain were used (Clontech). The coding sequence of ScDERB10 was fused in frame with the GAL4 DNA-binding domain (pGBKT7 vector) to produce the fusion construct of BD-ScDREB10 using the in-fusion PCR cloning system (Clontech); the full-length ORF of ScDREB10 was amplified from pMD18-T plasmids by PCR using gene-specific primers containing EcoR I and BamH I restriction sites, and the PCR product was inserted into the EcoR I/BamH I pGBKT7 vector. The construct was subsequently introduced into yeast Y2H Gold cells (Clontech). The yeast positive transformants were adjusted to an OD600 of 2.0, and the yeast cells were then 10-fold serially diluted and dropped with 2 µL on synthetic dropout (SD) medium without tryptophan (SD/−Trp), without tryptophan and histidine (SD/−Trp−His), and with SD/−Trp−His plates containing x-α-gal (5-Bromo-4-chloro-3-indolyl α-d-galactopyranoside) (SD/−Trp−His + x-α-gal). Yeast cells expressing containing the pGBKT7 empty vector or expressing GAL4 were used as the negative and positive control, respectively. The plates were incubated at 30 °C for 2 to 4 days before photographing. The primer information was listed in Table S1.

RT‐PCRs were performed on total RNA isolated from 3‐dpf‐old wild‐type larvae to generate partial dystrophin cDNA constructs, which were combined using the InFusion system (Clontech). The assembled cDNA encoded for dystrophin A0A0R4IXX0 (UniProt) missing P3531 and Q3532 of exon 76. According to previous dystrophin cloning results,²⁴ exon 78 (ENSDARE00001210285) was found to be non‐coding due to insertion of an additional exon between the annotated exons 77 (ENSDARE00001123314) and 78, resulting in GGRLNP at the C‐terminal end of dystrophin. The eGFP open reading frame was added at the 3′ end to the dystrophin cDNA, which was then placed into pDONR221 of the Gateway cloning system (Invitrogen) resulting in pME‐dmdGFP. pME‐dmd^∆ex1‐7GFP was prepared by the InFusion PCR cloning system (Clontech) using pME‐dmdGFP as template and the primers cDMD55F (5′‐gcaggctatgttgctacagtccatccaga‐3′) and cDMD66R (5′‐agcaacatagcctgcttttttgtacaaagtt‐3′). Both cloned plasmids were combined with p5E‐acta1, p3E‐polyA and pDestTol2pACryGFP to generate pcryGFP‐acta1‐dmdGFP and pcryGFP‐acta1‐dmd^∆ex1‐7GFP.²⁵, ²⁶, ²⁷ The resulting plasmids were microinjected into wild‐type 1‐cell stage embryos to generate the transgenic lines Tg(cry:GFP,acta1:dmdGFP) and Tg(cry:GFP,acta1:dmd^∆ex1‐7GFP). Animal experiments were approved by IBC/22219.