Aavs1 pur cag egfp

All vectors were constructed using Gibson assembly or standard restriction enzyme cloning. To make all the AAVS1-Pur-CAG-optoWnt plasmids, AAVS1-Pur-CAG-EGFP (Addgene, 80945) was digested with SalI and MluI, and the Cry2-LRP6c construct containing the photolyase homology region of the A. thaliana Cry2 protein (Bugaj et al., 2013 (link)) was inserted with standard restriction enzyme cloning. To generate β-catenin luciferase reporter lines, the 7xTFP vector (Addgene, 24308) was modified to replace puromycin resistance with hygromycin resistance. To generate the Brachyury-2A-eGFP donor plasmid (Bao et al., 2019 (link)), DNA fragments of ∼2 kb in length were PCR amplified from the endogenous genomic T locus, before and after the stop codon, and were cloned into the OCT4-2A-eGFP donor plasmid (Addgene, 31938). Two sgRNAs targeting at or near the T stop codon (1, CACTGCATCTTTCGGGACCTGGG; 2, TGGCGACACAGGTGTCCATGAGG) were cloned into the CRISPR-GFP plasmid (Bao et al., 2016 (link)) via T4 ligation. To generate shRNA knockdown lines, shRNA sequences (Table S3) were subcloned into the pLKO.1 lentiviral expression vector digested with AgeI and EcoRI, and modified to express the blastocydin-resistance gene and eGFP.