Ab45166

EZ-chromatin immunoprecipitation (ChIP) assay kit (Upstate Biotechnology) was used for the purification of sonicated nuclear lysates and immunoprecipitation (IP). In brief, RD cells were subjected to cross-linking in 1% formaldehyde and then incubated in 10X glycine to quench the reaction. Sonicated DNA fragments were immunoprecipitated with the indicated antibodies overnight [4 μg for H3K27ac (ab4729, Abcam), and 4 μg for H4K8ac (ab45166, Abcam)] and subsequently incubated with 40 μl of protein agarose G for 1 h. Precipitates were sequentially washed with the following buffers: (1) Low Salt buffer; (2) High Salt; (3) LiCl; and, (4) TE buffer. Precipitated chromatin DNA was released by incubating with protease K at 45°C for 2 h, purified using PCR purification kit (Qiagen), and analyzed by qPCR. The sequences of the pairs of primer sets used to amplify the target genomic regions were as follows. For KLK3 enhancer (5'- TGGGACAACTTGCAAACCTG, 5'-CCAGAGTAGGTCTGTTTTCAATCCA) ^{29 (link)}; for KLK2 promoter (5’- AAGGCTTTATAGGGCTCCTCA, 5’- AGACAAGGCGATGGAGAGAA); for 4EBP1 5’ UTR (5’-GCGCACAGGAGACCATGT, 5’-GGGGGTCGTGCTGTAGTC); for Cyclin D1 5’ UTR (5’-CGGACTACAGGGGAGTTTTG, 5’-CTCCCTCGCGCTCTTCTG); for mTOR 5’ UTR (5’-CTTAGAGGACAGCGGGGAAG, 5’-GTGCCAGGCCCTAGACTCAC).