To study the validity of the hot spot mutation appearing in ZNF419 in the MiSeq data (Dataset EV3 ), Sanger sequencing of the region was performed. The change was found in a region challenging to replicate due to sequence homology. In the resulting Sanger sequences, the change was observed in both tumors and normals, and therefore was deemed not somatic.
PCR fragments were amplified with Phusion enzyme (Thermo Fisher Scientific, Waltham, MA). Purification of the PCR products was performed with the ExoSAP‐IT PCR purification kit (USB Corporation, Cleveland, OH) or A'SAP PCR cleanup kit (Arctic Zymes, Tromsø, Norway), and the sequencing reactions were performed with the BigDye Terminator v.3.1 kit (Applied Biosystems) and run using 730xl DNA Analyzer (Applied Biosystems, Foster City, CA, at FIMM Genome and Technology Centre, Finland). PCR primers were designed with the Primer3 program (http://frodo.wi.mit.edu/primer3/ ) with GRCh37 as the reference sequence. The primer sequences are as follows: F: AAAGGCCTTACAAGTGCAGC, R: CCACTGTGAACTTTCTGGTGT. Analysis and visualization of the sequence graphs were performed with Mutation Surveyor software (version v4.0.8; Softgenetics, State College, PA).
PCR fragments were amplified with Phusion enzyme (Thermo Fisher Scientific, Waltham, MA). Purification of the PCR products was performed with the ExoSAP‐IT PCR purification kit (USB Corporation, Cleveland, OH) or A'SAP PCR cleanup kit (Arctic Zymes, Tromsø, Norway), and the sequencing reactions were performed with the BigDye Terminator v.3.1 kit (Applied Biosystems) and run using 730xl DNA Analyzer (Applied Biosystems, Foster City, CA, at FIMM Genome and Technology Centre, Finland). PCR primers were designed with the Primer3 program (