The largest database of trusted experimental protocols
Sourced in United States

KG1a cells are a type of human acute myeloid leukemia (AML) cell line. They are derived from the bone marrow of a patient with AML. KG1a cells are used for research purposes in the study of AML and can be used to test potential drug treatments or to investigate the biology of AML.

Automatically generated - may contain errors

10 protocols using kg1a cells

1

Propagation and Genetic Manipulation of RPE-1 and KG1a Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
hTERT RPE-1 cells (originally purchased from ATCC) were propagated in DMEM/F12 medium supplemented with 10% fetal bovine serum (FBS) and with 1% penicillin and streptomycin. For serum starvation, cells were grown until confluency, washed twice with serum-free media and then cultured in 0% FBS for 3–6 days. RPE-1 control and LIG4−/− knockout cell lines were a generous gift from Professor SP Jackson's laboratory (27 ). KG1a cells (originally purchased from ATCC) were cultured in IMDM medium supplemented with 10% FBS and with 1% penicillin and streptomycin. LIG4 knockdown KG1a cell line was generated using LIG4 shRNA MISSION Lentiviral Transduction Particles (Sigma-Aldrich, NM_002312). A total of 1 × 105 KG1a cells were incubated with 8μg/ml of polybrene and lentiviral particles (MOI = 5) overnight at 37°C. Cells were selected in 5μg/ml Puromycin and LIG4 expression was checked regularly. LIG4 (CAAGAUGUUUACAGAAAGGAA) and Control (Luciferase CGUACGCGGAAUACUUCGA) siRNA was transfected using RNAi Max (Invitrogen) according to manufacturer instructions 48 h before assays.
All cell lines were grown at 37°C, 5% CO2 and were regularly tested for mycoplasma contamination.
+ Open protocol
+ Expand
2

Culturing Promyeloblast Cell Line

Check if the same lab product or an alternative is used in the 5 most similar protocols
KG1a cells, a promyeloblast cell line derived from the bone marrow of a male AML patient was purchased from ATCC (cat. Number: CCL-246.1). There was no in house authentication carried out.
+ Open protocol
+ Expand
3

Characterization of CD34+ AML Cell Line KG-1a

Check if the same lab product or an alternative is used in the 5 most similar protocols
The CD34+ AML cell line (KG1a) was used in this research. KG-1a cells are a subtype of the progenitor cell line—KG-1. Various abnormalities developed in the KG-1 cells after 35 rounds of culture. These anomalies are mostly dependent on the karyotype, namely chromosomal rearrangements. For example, the first chromosome received a doubled long arm, the sixteenth chromosome’s deleted short arm, two copies of the twenty-second chromosome, and a lack of the Y chromosome, among other things [16 (link)]. The KG-1a cells (ATCC, Manassas, VA, USA) were stored, maintained, and cultivated according to “Handling information” (atcc.org, KG-1a–CCL-246.1). Cultivation was performed using IMDM media with 20% of Fetal Bovine Serum and 1% of Penicillin/Streptomycin (Gibco, Carlsbad, CA, USA) in the BINDER incubator (BINDER GmbH, Tuttlingen, Germany).
+ Open protocol
+ Expand
4

Culturing KG-1a Cells in IMDM

Check if the same lab product or an alternative is used in the 5 most similar protocols
KG-1a cells (ATCC, CL-246.1, Manassas, VA, USA) were cultured under standard cell culture conditions. For routine passaging, 2 × 105 cells in 5 mL culture medium (Iscove’s Modified Dulbecco’s Medium with 20% FCS) were transferred to a 25 mL culture flask.
+ Open protocol
+ Expand
5

Culture and Maintenance of Leukemia and CHO Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
KG1a cells (human acute myelogenous leukemia cell line, purchased from ATCC, Manassas, VA) were cultured in IMDM medium with 20% (v/v) heat-inactivated fetal calf serum (FCS) [24 (link)]. Nalm-6 cells (human pre-B ALL cell line; kindly provided by
C Patrick Reynolds at the children’s hospital of Los Angeles) were cultured in PRMI-1640 medium with 10% (v/v) heat-inactivated fetal calf serum (FCS) [4 (link)]. CHO cells (purchased from ATCC, Manassas, VA) were cultured in RPMI 1640-Glutamax-I medium containing 10% (v/v) heat-inactivated FCS [5 (link)]. All cell lines were cultured in media supplemented with 100 units/mL of penicillin and 100 μg/mL of streptomycin (Sangon Bioengineering Co., Shanghai, China) at 37°C in a humidified 5% CO2 incubator.
+ Open protocol
+ Expand
6

Culturing Diverse Hematological Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
OCI-AML3 cells (German Collection of Microorganisms and Cell Cultures [DSMZ], Braunschweig, Germany) were cultured in RPMI 1640 medium (#01-100-1ACS; Biological Industries; Kibbutz Beit-Haemek, Israel) containing 20% fetal bovine serum (FBS) (#10270-106; Gibco, Waltham, MA, USA). OCI-AML2 cells (DSMZ) were cultured in MEM-alpha medium (#12561-056, Gibco) containing 20% FBS. U937 (American Type Culture Collection [ATCC], Manassas, VA, USA), HL-60 (ATCC), and THP-1 (ATCC) cells were cultured in RPMI 1640 medium containing 10% FBS. KG-1a cells (ATCC) were cultured in IMDM (#SH30228.01; Hyclone, Logan, UT, USA) supplemented with 20% FBS. Human mesenchymal stem cells (hMSCs, China National Collection of Authentic Cell Cultures [NCACC]) were cultured in a mesenchymal stem cell medium (#7501; ScienCell, Carlsbad, CA, USA) containing 5% FBS. The 293T cell line (ATCC) was cultured in DMEM (#SH30243.01, Hyclone) supplemented with 10% FBS. IMS-M2 cell line was a kind gift from Dr. Li He at Zhongnan Hospital of Wuhan University (Wuhan, China) and cultured in RPMI 1640 medium containing 20% FBS. All cell lines were cultured at 37 °C in a humidified chamber in the presence of 5% CO2. Penicillin/streptomycin (#SV30010, Hyclone) was added to all cell cultures, except for the medium used for plasmid/siRNA transfection.
+ Open protocol
+ Expand
7

Disruption of Actin and Lipid Rafts in KG1a Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
KG1a cells, a human acute myelogenous leukemia cell line, purchased from the American Type Culture Collection, were maintained in Iscove’s modified Dulbecco’s medium (IMDM; Gibco) supplemented with 20% fetal bovine serum, penicillin (100 U ml−1), and streptomycin (100 μg ml−1) at 37°C in a humidified atmosphere containing 5% CO2. For the disruption of actin cytoskeletons, 106 ml−1 cells were treated with cytochalasin D (CytD; 3 μg ml−1; Sigma) in a prewarmed Hanks’ balanced salt solution (HBSS; Gibco) for 30 min at 37°C. For the disruption of lipid rafts, 106 ml−1 cells were treated by a prewarmed 10 mM MβCD (Sigma) and 10 mM Hepes buffer (Sigma) in a serum/antibiotic-free IMDM at 37°C for 30 min. The viability of the cells after the treatments was confirmed by trypan blue staining.
+ Open protocol
+ Expand
8

Isolation and Culture of Leukemia Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
KG1a cells (American Type Culture Collection, Manassas, VA), were grown in RPMI 1640 supplemented with 10% heat-inactivated fetal calf serum (FCS), 2 mM L-glutamine, 100 U/mL penicillin, and 0.1 mg/mL streptomycin (complete medium, CM) at 37°C in 5% CO2. Heparinized BM samples were obtained from 11 normal BM transplantation donors and during diagnostic procedures from 64 patients (median age, 52 years; range, 19–82; male/female, 28/36) with de novo (n=38) AML and AML with MDS-related features (n=26). Before sampling, informed consent was obtained according to the Declaration of Helsinki [47 (link)] and the procedures outlined by the ethical committee of our institution. Bone marrow mononuclear cells (BMMNCs) were isolated by density gradient centrifugation. After washing with phosphate-buffered saline (PBS; Life Technologies, Carlsbad, USA), BMMNCs were resuspended in Iscove’s modified Dulbecco’s Medium (IMDM) supplemented with 10% heat-inactivated FCS. RPMI 1640, IMDM, PBS, FCS, L-glutamine, penicillin, streptomycin, and lymphocyte separation medium were purchased from Life Technologies (Gaithersburg, MD).
+ Open protocol
+ Expand
9

Generation of Engineered Cell Lines for CAR T-cell Stimulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
EBV-transformed lymphoblastoid cell lines (LCLs) were made from PBMCs as previously described.17 (link) To generate muromonab-CD3 (OKT3)-expressing LCLs, LCLs were resuspended in nucleofection solution using the Amaxa Nucleofector kit T, OKT3-2A-Hygromycin_pEK plasmid was added to 5 µg/107 cells, the cells were electroporated using the Amaxa Nucleofector I, and the resulting cells were grown in Roswell Park Memorial Institute (RPMI)-1640 with 10% fetal calf serum (FCS) containing 0.4 mg/mL hygromycin.14 (link) To generate enhanced green fluoresent protein (eGFP) +LCLs, LCL cells were transduced with lentiviral vector encoding eGFP and eGFP +cells were purified by FACS sorting and expanded for use in these experiments. KG1a cells were purchased from American Type Culture Collection (ATCC) and transduced with lentiviral vector encoding eGFP. Banks of all cell lines were authenticated for the desired antigen/marker expression by flow cytometry prior to cryopreservation and thawed cells were cultured for less than 6 weeks prior to use in assays. To generate cells capable of stimulating the CMV-CD19CAR T cells via the CMV-specific TCR, autologous PBMCs were loaded with human cytomegalovirus (HCMV) PepMix (pp65pepmix) (>90%) (JPT peptide Technologies GmbH) at 1 µg/mL for 2 hours at 37C°. Cells were washed in PBS twice before use.
+ Open protocol
+ Expand
10

Culturing Human Leukemia Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Human acute promyelocyte leukemia HL-60 cells and acute myeloid leukemia KG1a cells were purchased from the American Type Culture Collection (ATCC)(Manassas, VA, USA) and cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS) (Gibco, USA), penicillin (100 U/mL, Gibco), and streptomycin (100 µg/mL, Gibco). These cells were maintained at 37 °C in an incubator with 5% CO2. Art was purchased from Sigma-Aldrich and dissolved in phosphate-buffered saline (PBS).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!