Beyort 3 first strand cdna synthesis kit

Manufactured by Beyotime

Sourced in China

The BeyoRT™ III First Strand cDNA Synthesis Kit is a laboratory tool designed for the reverse transcription of RNA into complementary DNA (cDNA). The kit contains the necessary reagents and components to perform this fundamental step in gene expression analysis and molecular biology research.

Automatically generated - may contain errors

Lab products found in correlation

Nanodrop one, by Thermo Fisher Scientific (4 mentions) Total rna extraction kit, by Solarbio (3 mentions) Quantinova sybr green pcr kit, by Qiagen (2 mentions) Powerup sybr green master mix, by Thermo Fisher Scientific (2 mentions) Talent qpcr premix, by Tiangen Biotech (1 mentions) Rnaprep pure micro kit, by Tiangen Biotech (1 mentions) Lightcycler 480 system, by Roche (1 mentions) Red blood cell lysis buffer, by Thermo Fisher Scientific (1 mentions) Rnaeasy animal rna isolation kit, by Beyotime (1 mentions) Beyofast sybr green qpcr mix 2x, by Beyotime (1 mentions) Beyozol reagent, by Beyotime (1 mentions) Beyofast sybr green qpcr mix kit, by Beyotime (1 mentions) Rnase r, by Geneseed (1 mentions) Stratagene mx3000p instrument, by Agilent Technologies (1 mentions) Trizol reagent, by Takara Bio (1 mentions) Beyofast sybr green one step qrt pcr kit, by Beyotime (1 mentions) Trizol reagent, by Beyotime (1 mentions) Nanodrop 2000c spectrophotometer, by Thermo Fisher Scientific (1 mentions)

10 protocols using beyort 3 first strand cdna synthesis kit

Quantitative PCR analysis of gene expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNAs were enriched using the RNAprep pure Micro Kit (Tiangen Biotech) following the supplier’s manual. cDNAs were synthesized using the BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime Biotech). The Talent qPCR PreMix (Tiangen Biotech) was used for the quantitative PCR on a LightCycler® 480 System (Roche). The primers are shown in Table 1. The fold changes of relevant mRNAs were calculated by the 2^−ΔΔCt method.Table 1.

Primer sequences.

Target	Sense (5^′ to 3^′)	Anti-sense (5^′ to 3^′)
ETV6	TGCCTTTCAAAACCACCCCT	TAGCCTCTATGTGCCCCACT
TNF-α	GCCTCTTCTCATTCCTGCTTG	CTGATGAGAGGGAGGCCATT
IL-1β	TGTCTGACCCATGTGAGCTG	GCCACAGGGATTTTGTCGTT
IL-6	ACTTCACAAGTCGGAGGCTT	TTCTGACAGTGCATCATCGCT
IL-10	AGGCGCTGTCATCGATTTCT	ATGGCCTTGTAGACACCTTGG
TGF-β1	CTGCTGACCCCCACTGATAC	GTGAGCGCTGAATCGAAAGC
β-actin	ACAACCTTCTTGCAGCTCCTC	CTGACCCATACCCACCATCAC

Xiong X., Yan Z., Jiang W, & Jiang X. (2022). ETS variant transcription factor 6 enhances oxidized low-density lipoprotein-induced inflammatory response in atherosclerotic macrophages via activating NF-κB signaling. International Journal of Immunopathology and Pharmacology, 36, 20587384221076472.

+ Open protocol

+ Expand

SCFA Receptor Expression in Hypertension

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

The three main SCFA-sensing receptors GPR41 (FFAR3), GPR43 (FFAR2), and GPR109A (HCAR2) have a role in cardiovascular dysfunction (28 (link)). As these receptors are highly expressed in immune cells (29 (link)), we quantified the mRNA expression of the 3 receptors in circulating immune cells in 30 participants. Since no blood samples were collected from the participants, we selected 30 samples(15 in HTE and 15 in HTL) from long-lived populations with hypertension characteristics collected earlier (23 (link)). The basic information of these samples is presented in Supplementary Table 3. Whole blood was treated with Red Blood Cell Lysis Buffer (ThermoFisher Scientific), and RNA was extracted using the Total RNA Extraction Kit (Solarbio). RNA was quantified in a Nanodrop Spectrophotometer, and the first-strand complementary synthesis reaction (cDNA) was made using the BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime). SYBR Green I was used in a Roche LIGHTCYCLER 96 Real-time quantitative PCR (qPCR) system (Roche Diagnostics Co., Ltd., Basel, Switzerland), with GAPDH as housekeeping genes (Supplementary Table 4). All expression experiments were run in duplicates, and significance was assessed by the 2–ΔΔCT method.

Zhang Q., Meng N., Liu Y., Zhao H., Zhao Z., Hao D., Li R., Han K., Li H., Ma J., Yu X., Qi Z, & Li Q. (2023). Protection effect of gut microbiota composition and acetate absorption against hypertension-induced damages on the longevity population in Guangxi, China. Frontiers in Nutrition, 9, 1070223.

+ Open protocol

+ Expand

Quantitative Analysis of NDUFA4L2 and GAPDH

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated using RNAeasy™ Animal RNA Isolation Kit (Beyotime Biotechnology) and converted to cDNA using BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime Biotechnology). qPCR was executed using BeyoFast™ SYBR Green qPCR Mix (2X) (Beyotime Biotechnology) on a QuantStudio apparatus (Applied Biosystems) with the following amplification program: an initial denaturation step 95°C for 2 min, followed by 40 cycles of 15s at 95 °C for denature and 30s at 60°C for annealing/extension. Primers 5′-ATGATCGGCTTAATCTGCCTG-3′ and 5′-TCCGGGTTGTTCTTTCTGTCC-3′ were used for NDUFA4L2, and primers 5′-GGAGCGAGATCCCTCCAAAAT-3′ and 5′-GGCTGTTGTCATACTTCTCATGG -3′ were for GAPDH.

Mei Q., Chen P., Lv Y., Zheng L., Liu D., Zhang M., Liu W, & Li P. (2024). Elevated of NDUFA4L2 expression in colon adenocarcinoma is correlated with an unfavorable prognosis and increased immune cell infiltration. Heliyon, 10(3), e25462.

+ Open protocol

+ Expand

Lung Tissue RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lung tissue (10 mg) was taken, and RNA was extracted with a total RNA extraction kit (R1200, Solarbio, China). After the extracted samples were quantified by the Nano Drop One ultraviolet-spectrophotometer (Thermo Scientific, China), the mRNA was reverse-transcribed into c-DNA by the BeyoRT III First Strand cDNA Synthesis Kit (D7178 M, Beyotime, China). Finally, fluorescence quantitative PCR detection was performed using the QuantiNova SYBR Green PCR Kit (Qiagen, Germany). The primers used for the qRT-PCR amplification are listed in Table 1.

Zhang Q., Feng A., Zeng M., Zhang B., Shi J., Lv Y., Cao B., Zhao C., Wang M., Ding Y, & Zheng X. (2021). Chrysosplenol D protects mice against LPS-induced acute lung injury by inhibiting oxidative stress, inflammation, and apoptosis via TLR4-MAPKs/NF-κB signaling pathways. Innate Immunity, 27(7-8), 514-524.

+ Open protocol

+ Expand

Quantifying Circular RNA Stability with RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissue samples and cell lysates using the Beyozol reagent (Beyotime, Shanghai, China). BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime) was used for the reverse transcription assay. BeyoFast™ SYBR Green qPCR Mix Kit (Beyotime) was used for PCR detection. The relative expression level of each gene was calculated using the 2^-∆∆Ct technique.¹⁷ Glyceraldehyde-phosphate dehydrogenase (GAPDH) for circ_0010235 or HOXA10 and U6 for miR-588 served as the internal controls. For analysis of stability, circ_0010235 and ALDH4A1 levels were determined by RT-qPCR after total RNA was performed with the treatment of RNase R (GENESEED). Reverse transcription using random or oligo (dT)₁₈ primers were used to identify the circular structure, followed by expression quantification of circ_0010235 and ALDH4A1. Table 2 shows the primer sequences.

Zhu H., Yang W., Cheng Q, & Yang S. (2022). Circ_0010235 Regulates HOXA10 Expression to Promote Malignant Phenotypes and Radioresistance in Non-small Cell Lung Cancer Cells Via Decoying miR-588. Balkan Medical Journal, 39(4), 255-266.

+ Open protocol

+ Expand

Quantification of Lung iNOS mRNA by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The mRNA level of iNOS in lung tissue was determined by quantitative real-time polymerase chain reaction (qRT-PCR) as described previously (Rungsung et al. 2018 (link)). In brief, total RNAs were isolated from the collected lung tissues with the help of Trizol reagent (TAKARA, Beijing, China) and were finally dissolved in diethylpyrocarbonate (DEPC; MACKLIN, Shanghai, China)-treated ddH₂O. Afterwards, the first strand of cDNA synthesis was fulfilled using a BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime Biotechnology, Shanghai, China). Then, the iNOS expression was determined using BeyoFast™ SYBR Green One-Step qRT-PCR Kit (Beyotime Biotechnology) with a Stratagene Mx3000P instrument (Agilent Technologies, California, USA). GAPDH was used as the internal control, and the 2^-ΔΔCt method was used to calculate iNOS expression. The sequences were as follows: inducible nitric oxide synthase (iNOS) (Forward) 5′-GGTGCTATTCCCAGCCCAA-3′, (Reverse) 5′-AGTCACATGCAGCTTGTCCA-3′; GAPDH (Forward) 5′-AGACAGCCGCATCTTCTTGT-3′, (Reverse) 5′-CCGATACGGCCAAATCCGTT-3′.

Xie Q., Wang Y, & Zou G.L. (2022). Protective effects of lavender oil on sepsis-induced acute lung injury via regulation of the NF-κB pathway. Pharmaceutical Biology, 60(1), 968-978.

+ Open protocol

+ Expand

Quantifying SIRT1 and miR-194-3p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from the tissues and cells according to the instructions provided by the manufacturer of the TRIzol reagent (R0016, Beyotime Biotechnology, Shanghai, China). Using 5 µg of RNA as a template, the reverse transcription reaction was performed using BeyoRT™ III First Strand cDNA Synthesis Kit (D7178L, Beyotime Biotechnology, Shanghai, China), according to the instructions. PCR was performed on a 7500 Fast Real-Time PCR System (ABI, USA) using PowerUp SYBR™ Green Master Mix (A25742, Thermo Fisher, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control for SIRT1 and U6 was used for miR-194-3p. The relative expression was analyzed using the 2^−ΔΔCt method. Primers were provided by Shanghai Gene Pharmaceutical Co., Ltd., China. The primary sequences used are presented in Table 1.

Table 1

Primer sequence

Genes	Orientation	Primer sequence (5’-3’)
SIRT1	Forward	TAGCCTTGTCAGATAAGGAAGGA
SIRT1	Reverse	ACAGCTTCACAGTCAACTTTGT
GAPDH	Forward	CTCGCTTCGGCAGCACA
GAPDH	Reverse	AACGCTTCACGAATTTGCGT
miR-194-3p	Forward	ACACTCCAGCTGGGCCAGTGGGGCTGCTGT
miR-194-3p	Reverse	TGGTGTCGTGGAGTCG
U6	Forward	CTCGCTTCGGCAGCACA
U6	Reverse	AACGCTTCACGAATTTGCGT
VP6	Forward	CAGTGATTCTCAGGCCGAATA
VP6	Reverse	GGCGAGTACAGACTCACAAA
Beclin1	Forward	CTGAGGGATGGAAGGGTCTAAGA
Beclin1	Reverse	CACGGTCCAGGATCTTGAAACTC

Huang H., Liao D., Zhou G., He B., Pu R, & Cui Y. (2023). MicroRNA-194-3p impacts autophagy and represses rotavirus replication via targeting silent information regulator 1. Virology Journal, 20, 210.

+ Open protocol

+ Expand

Kidney RNA Expression Analysis in Rats

Check if the same lab product or an alternative is used in the 5 most similar protocols

The upper part of the left kidney was selected, with three rats in each group, total RNA was extracted using total RNA extraction kit (R1200, Solarbio). Quantification was performed by NanoDrop™ One ultraviolet spectrophotometer (Thermo Scientific), followed by reverse transcription using BeyoRTTM III First Strand cDNA Synthesis Kit (D7178M, Beyotime) to obtain template DNA. Finally, the levels of tumor necrosis factor‐α (TNF‐α), interleukin‐6 (IL‐6), interleukin‐1β (IL‐1β), monocyte chemoattractant protein‐1 (MCP‐1), nephrin, desmin, phosphoinositide 3‐Kinase (PI3K), and serine/threonine‐protein kinase (AKT) were detected using QuantiNova™ SYBR green PCR kit (Qiagen). Table 1 shows the sequence of primers used for RT‐qPCR amplification.

Wang R., Zeng M., Zhang B., Zhang Q., Xie S., Hu Y., Fan R., Wang M., Yu X., Zhang Y., Zheng X, & Feng W. (2023). Epimedium sagittatum Maxim ameliorates adriamycin‐induced nephropathy by restraining inflammation and apoptosis via the PI3K/AKT signaling pathway. Immunity, Inflammation and Disease, 11(6), e904.

+ Open protocol

+ Expand

Quantitative RNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TriQuick reagent (Beyotime, Beijing, China) was used to extract total RNA from small intestinal tissue. The absorbance ratio at 260 and 280 nm was measured to quantify the purity and concentration of the retrieved RNA, employing a Thermo Scientific^TM NanoDrop^TM 2000C spectrophotometer (Waltham, MA, USA). The BeyoRTTM III First-Strand cDNA Synthesis Kit (Beyotime, Shanghai, China) was used to perform reverse transcription on the obtained RNA. The relative gene expression was subsequently measured with the CFX Connect real-qPCR system (BioRad, Hercules, CA, USA) and the SuperReal Preix Plus kit (SYBR Green) (Tiangen, Beijing, China). β-actin was used as a housekeeping gene and the data are expressed as relative values determined using the comparative threshold cycle (Cq) method (2^−ΔΔCq). All primers utilized in this research are detailed in Table 2.

Li Y., Chen Y., Li C., Wu G., He Y., Tan L, & Zhu K. (2024). Polysaccharide from Artocarpus heterophyllus Lam. (Jackfruit) Pulp Ameliorates Dextran Sodium Sulfate-Induced Enteritis in Rats. International Journal of Molecular Sciences, 25(3), 1661.

+ Open protocol

+ Expand

Exploring RgHDZ Gene Expression in Response to GG22 Stress

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze the expression profiles of RgHDZ genes in response to GG22 (R. glutinosa endophytic fungus) stress, the transcriptome data were used. Heatmaps were visualized with TB tools.^{65 (link)}4.6.3. qRT-PCR
In order to explore the role of RgHDZ genes in responding to biotic and abiotic stresses, 11 differentially expressed genes were selected from different branches of each subfamily of R. glutinosa HD-Zip phylogenetic tree. The relative expression of RgHDZ genes in the tissue cultured seedlings of R. glutinosa under various abiotic and biotic stresses treatments were analyzed by qRT-PCR. Significant up- and down-regulated genes were determined as p < .05 using T test.
The total RNA of R. glutinosa was extracted with TRIzon (Beijing ComWin Biotech). BeyoRTTM III First Strand cDNA Synthesis Kit (Beyotime Biotechnology, Shanghai, China) was used to synthesize the first cDNA strand, qRT-PCR primers of RgHDZ and a reference gene TIP41 are listed in Supplementary Table 3. The specific methods for qRT-PCR were performed according to Wang et al.^{66 (link)}

Zhu Y., Peng S., Zhao L., Feng W, & Dong C. (2022). Genome-wide identification and characterization of the HD-Zip gene family and expression analysis in response to stress in Rehmannia glutinosa Libosch. Plant Signaling & Behavior, 17(1), 2096787.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!