The largest database of trusted experimental protocols

Mmessage mmachin kit

Manufactured by Thermo Fisher Scientific
Sourced in United States

The MMESSAGE mMACHIN Kit is a laboratory instrument designed for the analysis and quantification of messenger RNA (mRNA) expression. The core function of this kit is to enable researchers to accurately measure and profile mRNA levels in various biological samples.

Automatically generated - may contain errors

8 protocols using mmessage mmachin kit

1

Zebrafish Morpholino and mRNA Injections

Check if the same lab product or an alternative is used in the 5 most similar protocols

tyw1 splice-blocking morpholino (MO; Gene Tools, OR, USA) sequence was 5′ AAC CTT ATT CCC ACT TAA TGT TAC C. gpam splice-blocking morpholino sequence was 5′ GGT GCT ACT TTT CTC CAA GCT TAC C. The sequence of a standard control MO oligo was 5′ CCT CTT ACC TCA GTT ACA ATT TAT A. tyw1 translation-blocking morpholino sequence was 5′ CAG CAT CTC ATG TAC TCT CTC CAT C. gpam translation-blocking morpholino sequence was 5′ ACG TCC ATC CCC TCT CTT CAA ACC A. The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. The wild-type and mutated cDNAs [TYW1 (NM_018264) mut1: p. R389Q; TYW1 mut2: p. R206C; GPAM (NM_001244949) mut1: p. G499R; GPAM mut2: p. P669S] containing the open reading frame of the zebrafish and human tyw1 or gpam genes were cloned into pCS2+ vector, respectively, and then were transcribed in vitro by using the mMESSAGE mMACHIN Kit (Thermo Fisher Scientific, MA, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, MA, USA), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Frankfurt, Germany). Around 2 nl of mRNA were injected at 50 ng/µl into half-cell stage embryos.
+ Open protocol
+ Expand
2

Overexpression of ifi30 and mCherry in Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
The coding sequence of ifi30 and mCherry were subcloned into pCS2 + vector, respectively. The recombinant plasmids were linearized with Not I restriction enzyme (NEB, R3189), and transcribed using the mMESSAGE mMACHIN Kit (Thermo Fisher Scientific, AM1340). For rescue and overexpression experiments, 2 nl ifi30 and mCherry mRNA mixture (1:1) was either co-injected with Ifi30-MO or injected alone into one-cell stage embryos. The injected mRNA concentration was 100 ng/ml.
+ Open protocol
+ Expand
3

Morpholino-mediated knockdown and mRNA overexpression in zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Thoc1 splice-blocking Morpholino (MOs; Gene Tools, USA) sequence was 5′- AGTAAGCTGTGGACTCACTATCTGC -3′. The sequence of a standard control MO oligo was 5′-CCTCTTACCTCAGTTACAATTTATA-3′. The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C. The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then was transcribed in vitro using the mMESSAGE mMACHIN Kit (Thermo Fisher Scientific, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, USA), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). 2 nl target genes mRNA were injected at 50 ng/μl into 1/2-cell stage embryos.
+ Open protocol
+ Expand
4

Zebrafish Nexmifa Knockdown and Rescue

Check if the same lab product or an alternative is used in the 5 most similar protocols
The nexmifa splice-blocking Morpholino (MO) and the standard control MO (Std MO) were synthesized by Gene Tools. The sequences are: 5′-AAAATGGTAGGAGTTATAAATGAGT-3′ and 5′-CCTCTTACCTCAGTTACAATTTATA-3, respectively. MOs were diluted to 0.3 mM in RNase-free water, injected into one-cell stage embryos, and then raised in E3 medium at 28.5°C to generate nexmifa knockdown embryos (morphants). To perform rescue experiments, we generated nexmifa mRNA, efna5b mRNA, and sema6ba mRNA in vitro. Briefly, we cloned zebrafish nexmifa, efna5b, and sema6ba separately into PCS2+ vectors. Next, we linearized plasmids, then in vitro synthesized mRNA using the mMESSAGE mMACHIN Kit (Ambion, Austin, Texas, United States) according to manufacturer’s instructions. Finally, we purified Capped mRNAs using the RNeasy Mini Kit (Qiagen, Hilden, Germany). MOs or mRNAs were injected into the yolk of one cell stage embryos using borosilicate glass capillaries (Sarasota, Florida, United States) and a PV830 pneumatic picopump (Sarasota, Florida, United States).
+ Open protocol
+ Expand
5

Morpholino Knockdown and mRNA Rescue in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Translation blocking antisense Morpholino (MOs; Gene Tools) against the ATG-containing sequence was designed (5′-AAATCCTCTGGGCATCTTCGCCAGC-3′) to target the translation start site according to the manufacturer's instruction and the other MO oligo (5′-CCTCTTACCTCAGTTACAATTTATA-3′) was used as standard control. The MOs were diluted to 0.3 mM with RNase-free water and injected into the yolk of one to two-cell stage embryos and then raised in E3 medium at 28.5°C.
The cDNAs containing the open reading frame of the target genes were cloned into PCS2+ vector respectively and then were transcribed in vitro using the mMESSAGE mMACHIN Kit (Ambion, USA) after the recombinant plasmids linearized with NotI Restriction Enzyme (NEB, England), and then the capped mRNAs were purified by RNeasy Mini Kit (Qiagen, Germany). 2 nl target genes and mCherry mRNA mixture (1:1) were injected at 20 ng/μl into 1/2-cell stage embryos.
+ Open protocol
+ Expand
6

Claudin h mRNA Expression in Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
The claudin h mRNA was transcribed in vitro using linearized artificial PCS2+ vector with the claudin h open reading frame cDNAs by the mMESSAGE mMACHIN Kit according to the manufacturer’s instruction (Ambion, United States). After purified using RNeasy Mini Kit (Qiagen, Germany), 2 nl capped mRNA was co-injected with claudin h Mo into one-cell stage embryos.
+ Open protocol
+ Expand
7

Mosaic Rescue of Sox2 Mutant in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols
Translation-blocking morpholino (5′-GCTCGGTTTCCATCATGTTATACAT-3′) against the ATG-containing sequence was synthesized by Gene Tools. Morpholino was diluted to 0.3 mM with RNase-free water and injected into one-cell stage embryos and then raised in E3 medium at 28.5°C for imaging.
The Sox2 cDNAs containing the open reading frame were cloned into PCS2+ vector. After this recombinant plasmid was linearized, the Sox2 mRNA was synthesized in vitro by the mMESSAGE mMACHIN Kit (Ambion, USA) according to the manufacturer’s instruction, and then the capped mRNAs were purified using RNeasy Mini Kit (Qiagen, Hilden, Germany). Two nanoliters of Sox2 mRNA was injected at 20 ng/μl into one-cell stage embryos.
The Sox2 ORF was cloned from the zebrafish by PCR, and then cloned into a pME-MCS vector to produce middle entry clone (pME-Sox2). p5E-mnx1 plasmid was obtained from Addgene. To generate an expression construct, p5E-mnx1, pME-Sox2, and p3E-polyA were combined with pDestTol2pA2 by the LR recombination reaction as described in the Lifetech Multiste Gateway Manual (Figure 5E; Life Technologies, Carlsbad, CA, USA). Subsequently, this construct was co-injected with tol2-transposase mRNA into one-cell stage Sox2 mutant zebrafish embryos to create the mosaic rescue zebrafish model.
+ Open protocol
+ Expand
8

Functional Analysis of fgfbp3 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Translation-blocking Morpholino that synthesized by Gene Tools was diluted to concentration of 0.3 mM to inject into one cell stage embryos. The sequence of fgfbp3 Mo is 5 ′ -ATGGCTGTGTTGATAAA-GAGCATTT-3 ′ . The open reading frame of fgfbp3 was amplified and cloned into PCS2 + vector. After linearized, the 5 ′ -capped fgfbp3 mRNA was synthesized and purified in vitro by the mMESSAGE mMACHIN Kit (Ambion, USA) and RNeasy Mini Kit (Qiagen, Germany), respectively. 100-200 pg of the purified mRNA was injected into one-cell stage embryos.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!