Pcr thermal cycler mp

In order to analyze CpG island hypermethylation of hBD-2, the methylation profiles were assessed using a methylation-specific PCR (MSP) method, similar to that reported by Herman et al (13 (link)). Briefly, DNA was extracted from the cultured cells with DNeasy Blood & Tissue kit (Qiagen, Stanford, CA, USA) according to the manufacturer’s protocol. The DNA was purified using a phenol/ethanol method. MSP distinguishes unmethylated from methylated alleles in a given gene based on sequence changes produced after bisulfite treatment of DNA, which converts unmethylated (but not methylated) cytosines to uracil, and subsequent PCR using primers designed for either methylated or unmethylated DNA. The primer sequences are listed in Table I. PCR was performed using an amplification kit (AmpliTag Gold; Applied Biosystems) and a thermal cycler (Takara PCR Thermal Cycler MP; Takara, Osaka, Japan). Each PCR product was loaded directly onto non-denaturing 2% agar gels. As a positive control for methylation, CpGenome™ Universal Methylation DNA (Millipore, Billerica, MA, USA) was used.

The expression of DPP4 mRNA by BECs and the expression of FN mRNA by HFL-1 and BSMCs were determined by reverse transcription (RT), followed by real-time quantitative PCR as described previously [4 (link), 5 (link)]. First-strand cDNA was synthesized using the PrimeScript RT reagent Kit (TaKaRa) with both oligo(dT) primers and random hexamers.
Reverse transcription was performed with a TaKaRa PCR Thermal Cycler MP (TP3000). The following are the sequences of the primers used for amplification of DPP4, FN and GAPDH:

DPP4: forward primer, GCACGGCAACACATTGAA;

reverse primer, TGAGGTTCTGAAGGCCTAAATC;

FN: forward primer, CTTTGGTGCAGCACAACTTC;

reverse primer, CCTCCTCGAGTCTGAACCAA

GAPDH: forward primer, GCACCGTCAAGGCTGAGAAC;

reverse primer, TGGTGAAGACGCCAGTGGA.

DNA was amplified for 40 cycles of denaturation for 5 s at 95 °C and annealing for 30 s at 60 °C, using the TaKaRa Thermal Cycler Dice (TP900). The PCR assays were performed and analyzed using the Thermal Cycler Dice Real Time System version 4.2 (TaKaRa). The specificity of reactions was determined by melting curve analysis. The relative expression of each gene of interest and of GAPDH were calculated using the ΔΔCt method.

ChIP assay was performed by the ChIP-IT^TM kit (Active Motif, Tokyo, Japan) according to the manufacturer’s instructions. Chromatin was immunoprecipitated with rabbit LXR antibody (Santa Cruz Biotechnology Inc., Dallas, CA, USA) by using control IgG as a negative control. DNA containing the putative LXR-binding sites on rat ABCA1 promoter was amplified by PCR using forward primer 5′-GCTTTCTGCTGAGTGACTGAACTAC-3′ and reverse primer: 5′-GAATTACTGCTTTTTGCCGCG-3′ as described previously [17 (link)]. PCR was performed using TAKARA PCR thermal cycler MP in the following amplification conditions: 95 °C for 5 min, followed by 36 cycles of 95 °C for 20 s, 59 °C for 30 s, and 72 °C for 30 s. PCR products (229 bp) were detected by 3% agarose gel electrophoresis.