Primescript rt kit

Briefly, the total RNA was extracted from primary osteosarcoma cells and normal cortical bone cells using TRIzol reagent (Invitrogen, Waltham, MA, USA), and then the total RNA was reverse-transcribed into cDNA by the PrimeScript™ RT Kit (Invitrogen, Waltham, MA, USA). qRT-PCR was carried out with SYBR Green under the CFX96 qRT-PCR System. The sequences of qRT-PCR primers used in this study are as follows: GAPDH, CCTGGTCACCAGGGCTGCCATTT (forward) and CGTTGAATTTGCCGTGAGTGGAG (reverse); CYR61, TGTCGCCGTCACCCTTCTCCACTT (forward) and TTAGCGCAGACCTTACAGCAGCCG (reverse); CTGF, TGCTATGGGCCAGGACTGCA (forward) and AGTTCTCCCAGCTGCTTGGC (reverse).

Total RNA extraction from tissues and cells was routinely performed by utilizing the TRIzol (Invitrogen, Carlsbad, CA, USA) method [30 (link)]. After the purity test, miRNA, LncRNA, and mRNA underwent reverse transcription into cDNA using the mirPremier® microRNA Isolation Kit (Sigma, St. Louis, MO, USA) and the PrimeScript RT kit (Invitrogen, Shanghai, China), respectively. Then, we adopted the SYBR®Premix-Ex-Taq™ (Takara, TX, USA) and the ABI7300 system for qRT-PCR. GAPDH served as a housekeeping gene to verify the mRNA levels of LncRNA MIR17HG, SNCA, IL-1β, interleukin-6 (IL-6), TH, and tumor necrosis factor (TNF-α). In contrast, U6 served as that of miR-153-3p. The primer sequences for each molecule are as follows. MIR17HG: F: 5’-TGTGCAGATTGAGCTCTCCT-3’, R: 5’-TCCTGACAAAATGCAGCCTG-3’; miR-153-3p: F: 5’-AATCGGCGTTGCATAGTCACAAA-3’; R: 5’-CAGTGCAGGGTCCGAGGT-3’; SNCA: F: 5’-GACTGGGCACATTGGAACTG-3’; R:5’-TGCCTGTGGATCCTGACAAT-3’; GAPDH: F: 5’-CTCCTCCTGTTCGACAGTCAGC-3’; R: 5’-CCCAATACGACCAAATCCGTT-3’. IL-1β: F: 5’-TCATCTTTTGGGGTCCGTCA-3’; R: 5’-GGCTCATCTGGGATCCTCTC-3’; IL-6: F: 5’-TTTCACCAGGACCGTCTCTCCT-3’; R:5’-AGACAGCCACTCACCTCTTC-3’; TNF-α: F: 5’-ATCCCAGGTTTCGAAGTGGT-3’; R: 5’-TCTGGGCAGGTCTACTTTGG-3’; TH: F: 5’-GCGTGGACAGCTTCTCAATT-3’; R: 5’-TGTTCCAGTGCACCCAGTAT-3’. U6: F: 5’-CTCGCTTCGGCAGCACATATACTA-3’; R:5’-ACGAATTTGCGTGTCATCCTTGC-3’.

Total RNA was extracted using Trizol reagent (15,596,026, Invitrogen). Reverse was transcribed into cDNA according to the instructions of PrimeScript RT kit (A15300, Invitrogen). qPCR was carried out using SYBR Green PCR Kit (4,367,659, Applied biosystems). β-actin served as internal control. The primers (Caspase 6, IL-1β, TNF-α, CXCL-10, β-actin) were listed in Supplementary Table 2.

To USP15 mRNA, we employed the widely accepted Trizol-based protocol, a standardized method known for its effectiveness. Following the manufacturer’s instructions, we conducted a semi-quantitative analysis of the resulting amplification product subsequent to the USP15 amplification process. This analysis was skillfully executed using the PrimeScript RT Kit (Invitrogen, USA) in conjunction with the SYBR Premix Ex Taq (TaKaRa, Beijing, China) to ensure accurate and reliable measurements.

BMMs were treated with full medium combining with M-CSF, RANKL, and serial dilutions of GSK (0, 1, 2, and 5 μM) for 5 days or 1, 3, or 5 days. Trizol (Invitrogen) was used to extract total RNA in a volume of 500 μL, and Prime Script RT kit was used to synthesize the cDNA. The qRT-PCR was performed at least triple times using ABI Prism 7500 (Norwalk, USA). The 2^-ΔΔCT method was performed and calculated to analyze results in which data were normalized using the relative expression of GAPDH as control. The primer sequences used in present study for RT-PCR could be seen at Table 1.