Pdonr201

Manufactured by Thermo Fisher Scientific

Sourced in United States, Germany

The PDONR201 is a laboratory instrument designed for precise and efficient liquid handling. It features a compact and user-friendly design, enabling accurate pipetting of various sample volumes. The core function of this product is to facilitate liquid transfer and measurement tasks in scientific research and analytical laboratories.

Automatically generated - may contain errors

Lab products found in correlation

51 protocols using pdonr201

Cloning and Expression of Arabidopsis Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

AtENGD-1 (At1g30580) was cloned into pDONR207 (Thermo Fisher Scientific Inc., Carlsbad, CA, United States) using primers 5′GGGGACAAGTTTGTACAAAAAAGCAGGCTYYA TGCCTCCGAAAGCCAAA3′ and 5′GGGGACCACTTTGTA CAAGAAAGCTGGGTYTCATTTCTTCCCACCACCG3′, and subsequently transferred to pET59-DEST^TM (EMD Millipore, Burlington, VA, United States) to generate 6X-His-AtENGD-1.
A plasmid harboring AtRPN1A (At2g20580) epitope tagged with Myc (Myc-AtRPN1A) was obtained from the Arabidopsis Biological Resource Center (ABRC) stock collection².
AtCCoAOMT1 (At4g34050) was cloned into pDONR201 (Thermo Fisher Scientific Inc., Carlsbad, CA, United States) using primers 5′GGGGACAAGTTTGTACAAAAAAGCAGGC TYYATGGCGACGACAACAACA3′ and 5′GGGGACAAGTTT GTACAAAAAAGCAGGCTYYATGCCTCCGAAAGCCAAA3′ and subsequently transferred to pEarleyGate201 (Earley et al., 2006 (link)) to generate HA-AtCCoAOMT1.
Full length AtNHR2B and truncated AtNHR2B₁_–₁₄₀ in pDONR201 were transferred to pSITEnEYFPC1 (Martin et al., 2009 (link)). AtCCoAOMT1 was cloned into pSITEcEYF PC1(Martin et al., 2009 (link)).
Plasmids harboring Myc-AtRPN1A, HA-AtCCoAOMT1, AtCCoAOMT1-cEYFP, AtNHR2B-nEYFP, and AtNHR2B₍₁_–₁₄₀₎-nEYFP were transformed into Agrobacterium tumefaciens strain GV2260 by electroporation for transient gene expression in N. benthamiana. pET59-DEST:AtENGD-1 was transformed into E. coli strain Rosetta for protein expression and purification.

Singh R., Liyanage R., Gupta C., Lay JO J.r., Pereira A, & Rojas C.M. (2020). The Arabidopsis Proteins AtNHR2A and AtNHR2B Are Multi-Functional Proteins Integrating Plant Immunity With Other Biological Processes. Frontiers in Plant Science, 11, 232.

+ Open protocol

+ Expand

Cloning and Mutagenesis of CLE19 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

A CLE19 genomic fragment containing a 1782bp 5′ upstream region (pCLE19), 225bp coding region, and a 1205bp 3′ downstream region (tCLE19) was amplified and cloned into pDONR201 (Invitrogen) to construct the pDONR201-pCLE19:CLE19:tCLE19 entry clone. To generate a glycine to threonine substitution (G6T) at the sixth amino acid (G6) of the CLE motif, a Fast Mutagenesis Kit (TransGen, Beijing) was used to introduce point mutations into pDONR201-pCLE19:CLE19:tCLE19 to produce pDONR201-pCLE19:CLE19_G6T:tCLE19, which was then transferred to the pBGWFS7 binary vector to generate pCLE19:CLE19_G6T:tCLE19. pCLE19 and tCLE19 were cloned into the ligation-independent cloning vectors pPLV04 and pPLV15 (De Rybel et al., 2011 (link)) to generate pCLE19:SV40-3XGFP:tCLE19 and pCLE19:GUS:tCLE19, respectively. pWOX1:SV40-3XGFP, pWOX3:SV40-3XGFP, and pALE1:SV40-3XGFP were made in a similar manner using pPLV04 (De Rybel et al., 2011 (link)). The pALE1:CLE19_G6T construct was made by replacing the SV40-3XGFP cassette in pALE1:SV40-3XGFP with the CLE19_G6T coding sequence.

Xu T.T., Ren S.C., Song X.F, & Liu C.M. (2015). CLE19 expressed in the embryo regulates both cotyledon establishment and endosperm development in Arabidopsis. Journal of Experimental Botany, 66(17), 5217-5227.

+ Open protocol

+ Expand

Cloning and Transformation of StLRPK1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The coding region of StLRPK1 was digested from the pMD18-T-StLRPK1 construct by using HindIII/BamHI enzymes and inserted into pBI121. For the RNAi vector, a non-conserved fragment of StLRPK1 was amplified by the attB1-StLRPK1-RNAi-F and attB2-StLRPK1-RNAi-R primers (see Supplementary Table S1 at JXB online) and recombined into the entry vector pDONR201 using BP clonase (Invitrogen), followed by recombination into pHellsgate8 using LR clonase (Invitrogen). pBI121-StLRPK1 and pHellsgate8-StLRPK1 vectors were transformed into Agrobacterium tumefaciens strain LBA4404 by electroporation and cultured on YEB medium containing appropriate antibiotics. StLRPK1-GFP, StSERK3A-cMyc, and NbSERK3A-cMyc were cloned from potato and N. benthamiana by PCR with gene specific primers (Supplementary Table S1) modified to contain the Gateway (Invitrogen) attB recombination sites. The PCR products were recombined into pDONR201 (Invitrogen) to generate entry clones, followed by recombination into pK7FGWT7, PGWB17, and PGWB20 (Nakagawa et al., 2007 (link)), respectively, by using LR clonase (Invitrogen), Vectors were then transformed into A. tumefaciens strain GV3101. cMyc-StBSL1-PGWB18 was described by Saunders et al (2012) (link).

Wang H., Chen Y., Wu X., Long Z., Sun C., Wang H., Wang S., Birch P.R, & Tian Z. (2018). A potato STRUBBELIG-RECEPTOR FAMILY member, StLRPK1, associates with StSERK3A/BAK1 and activates immunity. Journal of Experimental Botany, 69(22), 5573-5586.

+ Open protocol

+ Expand

Cloning and Characterization of BR Signaling Components

Check if the same lab product or an alternative is used in the 5 most similar protocols

Full-length cDNAs of BZR1 and BZR2 without stop codons were amplified from cDNA template synthesized from Col-0 gDNA and cloned into the Gateway-compatible donor vector pDONR201 (Invitrogen, Waltham, MA, USA). GUS and BR gene donor clones were moved by LR reaction into split luciferase vector pCAMBIA-NLuc, while a TCP8 donor clone was moved into pCAMBIA-CLuc (Chen et al., 2008) .
GFP-TCP8 and RFP-BZR2 constructs were made by Gateway LR reaction (Invitrogen) from pDONR201 clones into pMDC83 (Curtis and Grossniklaus, 2003) and pSITE-4CA (Chakrabarty et al., 2007) , respectively.
BR gene donor clones were used as template for PCR-based addition of BamHI and SmaI restriction sites to the CDS. Products were digested and ligated into corresponding restriction sites in the GST-tag vector pGEX-4T3 (GE Healthcare, Chicago, IL, USA).
For transactivation experiments, 2-kb upstream regions of BZR1 and BZR2 were cloned into pDONR201. Mutant tcp variants of the promoters were generated by site-directed mutagenesis. Donor clones were moved by Gateway LR reaction into pYXT1 (Xiao et al., 2005) to produce complete promoter-reporter constructs.

Spears B.J., McInturf S.A., Collins C., Chlebowski M., Cseke L.J., Su J., Mendoza-Cózatl D.G, & Gassmann W. (2022). Class I TCP transcription factor AtTCP8 modulates key brassinosteroid-responsive genes. Plant physiology, 190(2).

+ Open protocol

+ Expand

Constructing Lentiviral Expression Systems

Check if the same lab product or an alternative is used in the 5 most similar protocols

Expression constructs that contain sequences that code for EAV nsp2 and nsp3 were assembled in pDONR201 (Life Technologies, Inc.) with an HA tag at the N terminus of nsp2 and enhanced GFP (eGFP) fused to the C terminus of nsp3. The pDONR construct was then transferred using LR Clonase II (Life Technologies, Inc.) to either pcDNA3.1-DEST or pLenti6.3/TO/V5-DEST (Life Technologies, Inc.). Helper plasmids for lentivirus particle production have been described previously (51 (link)), and pLenti3.3/TR carrying the tetR gene was purchased from Life Technologies, Inc. (34 (link)). To make CRISPR/Cas9 knockout cell lines, the LentiCrisprv2 vector was used as previously described (52 (link), 53 (link)). Guide RNA sequences are listed in Table S1 in the supplemental material (54 (link)).

Oudshoorn D., van der Hoeven B., Limpens R.W., Beugeling C., Snijder E.J., Bárcena M, & Kikkert M. (2016). Antiviral Innate Immune Response Interferes with the Formation of Replication-Associated Membrane Structures Induced by a Positive-Strand RNA Virus. mBio, 7(6), e01991-16.

+ Open protocol

+ Expand

CEP192 Phosphatase Binding Motif Mutagenesis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Residues 507–1065 (containing the ‘KHVTF’ motif) of human CEP192 were amplified from a pEGFP-C1-CEP192 construct by PCR using Gateway compatible primers and inserted into pDONR201 via BP ligation reaction (Life Technologies). This construct was subcloned into bacterial expression vector pDEST42 to create a C-terminal V5 and 6XHis tagged fusion construct (CEP192-WT). The putative PP1 binding motif ‘KHVTF’ in this construct was mutated to ‘KHATA’ (CEP192-RARA) by site-directed mutagenesis following the manufacturers’ protocol. The constructs were sequence verified by Eurofin MWG Operon LLC sequencing.

Nasa I., Trinkle-Mulcahy L., Douglas P., Chaudhuri S., Lees-Miller S.P., Lee K.S, & Moorhead G.B. (2017). Recruitment of PP1 to the centrosomal scaffold protein CEP192. Biochemical and biophysical research communications, 484(4), 864-870.

+ Open protocol

+ Expand

Overexpression Constructs for Drosophila Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

DmAngel and CG13850 cDNAs were PCR amplified with or without an in frame STOP codon and flanking attB sites for cloning into pDONR201 (Thermo Fisher Scientific), before subcloning into pTWF (Drosophila Genomics Resource Center), and finally into pUASTattB with or without a FLAG tag at their 3′ ends. The overexpressing lines were generated via P-element-mediated germ line transformation, by injecting pUASTattB-DmAngel, pUASTattB-DmAngel-FLAG, pUASTattB-CG13850, or pUASTattB-CG13850-FLAG plasmids into Drosophila embryos using BestGene Inc. Primers used to generate the constructs are detailed in Supplementary Data File 2.

Clemente P., Calvo-Garrido J., Pearce S.F., Schober F.A., Shigematsu M., Siira S.J., Laine I., Spåhr H., Steinmetzger C., Petzold K., Kirino Y., Wibom R., Rackham O., Filipovska A., Rorbach J., Freyer C, & Wredenberg A. (2022). ANGEL2 phosphatase activity is required for non-canonical mitochondrial RNA processing. Nature Communications, 13, 5750.

+ Open protocol

+ Expand

Recombinant RS1 Protein Production

Check if the same lab product or an alternative is used in the 5 most similar protocols

Regions from a pTOPO-RS1 vector (Zeng et al., 2004 (link)) were amplified, using standard PCR to generate mature RS1 in tandem with a hexahistine tag (aa 24–224-6xHis). The sense (Topo-RS1-F) and antisense (Topo-RS1-R) primers listed in Table S1 also included sequences for Gateway recombination sites and were obtained from Eurofins MWG Operon. PCR was performed using Phusion polymerase (New England Biolabs) under standard conditions with a 30-s/kB extension time for five cycles. After that time, 200 nM of the adapter primer (see Table S1) was added, and amplification was continued for an additional 15 cycles to introduce the honeybee melittin (HBM) leader sequence and Gateway sites. PCR products were cleaned using the QIAQuick PCR purification kit (Qiagen). The final PCR product contains RS1 cDNA with an amino terminal insect HBM secretion signal sequence on the 5′ end and appropriate Gateway recombination sites on both ends. The cleaned PCR products were recombined into pDonr253 (Gateway Donor vector modified from pDonr201; Thermo Fisher Scientific) vector using the Gateway BP recombination reaction according to the manufacturer’s protocols. The subsequent Entry clones (11109-E01 HBM-RS1aa24-224-6xHis;) were sequence verified throughout the entire cloned region.

Heymann J.B., Vijayasarathy C., Huang R.K., Dearborn A.D., Sieving P.A, & Steven A.C. (2019). Cryo-EM of retinoschisin branched networks suggests an intercellular adhesive scaffold in the retina. The Journal of Cell Biology, 218(3), 1027-1038.

+ Open protocol

+ Expand

Generating Mutant HAAO and KYNU cDNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

pDONR201 HAAO was generated as described (Szot et al., 2020 (link)). Variants c.128G>A p.(Arg43Lys), c.141C>A p.(His47Gln), c.43del p.(Arg15Glyfs*99), c.301G>T p.(Gly101Trp), and c.323G>A p.(Arg108Gln) were introduced into pDONR201 HAAO cDNA by site-directed mutagenesis with primers listed in Supp. Table S1. HAAO wild-type and mutant cDNA inserts were then transferred to pAG416GPD (Addgene plasmid #14148) by Gateway LR reaction. Human KYNU cDNA was amplified from Origene:RC214932 using cloning primers (Supp. Table S1), then gateway cloned into pDONR201 via BP reaction (Thermo Fisher) according to manufacturer’s instructions. Variants c.788A>G p.(His263Arg), c.616G>A p.(Glu206Lys), c.361_363del p.(Lys121del), c.1035T>A p.(Ser345Arg), c.489del p.(Ala164Profs*26), c.1282C>T p.(Arg428Trp), c.592A>G p.(Thr198Ala), and c.170-1G>T p.(Val57Glufs*21) were introduced into pDONR201 KYNU via site-directed mutagenesis with primers listed in Supp. Table S1. Finally, KYNU wild-type and mutant cDNA inserts were then transferred to pAG416GPD by Gateway LR reaction. All introduced variants were confirmed by Sanger sequencing.

Szot J.O., Slavotinek A., Chong K., Brandau O., Nezarati M., Cueto-González A.M., Patel M.S., Devine W.P., Rego S., Acyinena A.P., Shannon P., Myles-Reid D., Blaser S., Mieghem T.V., Yavuz-Kienle H., Skladny H., Miller K., Riera M.D., Martínez S.A., Tizzano E.F., Dupuis L., Stavropoulos D.J., McNiven V., Mendoza-Londono R., Elliott A.M., Phillips R.S., Chapman G, & Dunwoodie S.L. (2021). New Cases that Expand the Genotypic and Phenotypic Spectrum of Congenital NAD Deficiency Disorder. Human mutation, 42(7), 862-876.

+ Open protocol

+ Expand

Retroviral Transduction of Human OXA1L

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full‐length human OXA1L cDNA (mammalian genome collection clone BC001669) was amplified by PCR (KAPA HiFi), cloned into pDONR 201 with BR Clonase II (Thermo Fisher) and subsequently cloned into the Gateway converted retroviral vector pBABE‐puro with LR Clonase II. Retrovirus was generated by transient transfection of retroviral plasmids into the Phoenix amphotropic packaging line. Transduced fibroblasts were used directly in experiments following selection with puromycin.

Thompson K., Mai N., Oláhová M., Scialó F., Formosa L.E., Stroud D.A., Garrett M., Lax N.Z., Robertson F.M., Jou C., Nascimento A., Ortez C., Jimenez‐Mallebrera C., Hardy S.A., He L., Brown G.K., Marttinen P., McFarland R., Sanz A., Battersby B.J., Bonnen P.E., Ryan M.T., Chrzanowska‐Lightowlers Z.M., Lightowlers R.N, & Taylor R.W. (2018). OXA1L mutations cause mitochondrial encephalopathy and a combined oxidative phosphorylation defect. EMBO Molecular Medicine, 10(11), e9060.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!