The peach variety “Xiahui 5” is planted in the experimental base of Shandong Agricultural University, with fruit round, creamy yellow pericarp, more than 80% of the fruit surface with red, white meat, delicate flesh, ripe in mid-July, and a fruiting time of about 100 days [33 (link)]. Samples of leaves, stems, flowers, and fruits were collected. Total RNA was extracted from the samples using an RNA extraction kit (Tiangen, Beijing, China), and the RNA purity was determined using an ultra-micro UV analyzer to confirm that the OD260/OD230 ratio was between 1.8 and 2.1. First-strand cDNA was synthesized using the PrimeScript first-strand cDNA synthesis kit (Takara, Dalian, China). Real-time quantitative polymerase chain reaction (qRT-PCR) was performed on the ABI7500 system using the SYBR premix ExTaq (Takara, Dalian, China) with the following procedure: 95 °C for 5 min, followed by 45 cycles at 95 °C for 10 s, 58 °C for 10 s, and 72 °C for 20 s. Reaction volume is 25 μL (including UItraSYBR Mixture (CWBIO, Taizhou, China) 12.5 μL, primer-F 0.5 μL, primer-R 0.5 μL, ddH2O 10.5 μL, cDNA 1 μL), with three biological replicates per sample. The relative expression level was calculated by the 2−ΔΔCT method [34 (link)]. Primers for qRT-PCR are listed in Table S1 .
Uitrasybr mixture
Manufactured by CWBIO
Sourced in China
UltraSYBR Mixture is a reagent used in qPCR (quantitative Polymerase Chain Reaction) experiments. It contains the necessary components for the detection and quantification of target DNA sequences, including a DNA-binding fluorescent dye and a DNA polymerase enzyme.
Automatically generated - may contain errors
Lab products found in correlation
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (4 mentions)
Stratagene mx3000p qpcr system, by Agilent Technologies (2 mentions)
Primescript first strand cdna synthesis kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Rna extraction kit, by Tiangen Biotech (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Revertra ace qpcr rt kit, by Toyobo (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Other oligonucleotides, by Sangon (1 mentions)
Deep vent dna polymerase, by New England Biolabs (1 mentions)
Dntps, by Solarbio (1 mentions)
T4 dna ligase, by New England Biolabs (1 mentions)
Oligonucleotides, by GenScript (1 mentions)
Cfx96 touch real time pcr detection system, by Bio-Rad (1 mentions)
7 protocols using uitrasybr mixture
1
Transcriptomic Analysis of Peach Variety Xiahui 5
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRI Reagent (Sigma, USA) and was reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, USA). Real-time quantitative PCR was performed in a 25 μl reaction system containing diluted cDNA, specific primers (10 μM) and UItraSYBR Mixture (CWBio, China) using Stratagene Mx3000P QPCR system (Agilent Technologies, USA). The levels of mRNA expression were normalized to the endogenous control GAPDH. The results were expressed as fold changes compared with the control group which was set to 100%. The primer pairs were listed in Table 1 .Table 1
Primer sequences for real-time PCR.
| Primer | Sense primer (5–3′) | Antisense primer (3–5′) |
|---|---|---|
| BRCA1 | AGTAGCCAGCACCAAACA | AAACCTCACATTCACATCAAA |
| TNF-α | AGACAGAGGCAACCTGACCAC | GCACCACCATCAAGGACTCAA |
| IL-6 | GCACTAGGTTTGCCGAGTAGA | AAGCTGGAGTCACAGAAGGAG |
| NRF2 | GTCTTTTGTGAATGGGGCTTTT | CAGTGCTCCTATGCGTGAATC |
| HO-1 | CCACATTGGACAGAGTTCACAG | CCTCACAGATGGCGTCACTTC |
| NQO1 | TGGCGTAGTTGAATGATGTCTT | TTCGGTATTACGATCCTCCCT |
| GPX4 | ACGCAGCCGTTCTTATCAATG | GGCAGGAGCCAGGAAGTAATC |
| GCLC | CATCGGGTGTCCACATCAACT | ATCAATGGGAAGGAAGGGGTAT |
| GCLM | GCAGAATGTAGCCTTTAGACTTGA | GTGATGCCACCAGATTTGACT |
| SOD1 | ACCGTCCTTTCCAGCAGTCAC | ATGGGTTCCACGTCCATCAGT |
| SOD2 | AGCAGGCAGCAATCTGTAAGC | CACTGAAGTTCAATGGTGGGG |
| GAPDH | AAGAAGGTGGTGAAGCAGG | GAAGGTGGAAGAGTGGGAGT |
3
RNA Extraction, Reverse Transcription, and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the tissues and cells by TRIzol reagent (Ambion, Austin, TX, USA), and the concentration, purity, and integrity of the extracted RNAs were determined by a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). Then, these RNAs were reverse‐transcribed to cDNA by the ReverTra Ace qPCR RT Kit (TOYOBO, Osaka, Japan) following the manufacturer's instructions. The obtained cDNAs were used as templates to be amplified by using the UItraSYBR Mixture (CWBIO, Jiangsu, China) on the Real‐Time PCR CFX96 Detection System (Bio‐Rad, Hercules, CA, USA) to perform RT–qPCR. U6 snRNA was used as the internal control for the normalization of the miRNA expression, and GAPDH was used for the normalization of the lncRNA and mRNA expression. The primers involved in the experiment are shown in Table 1 .
4
Quantification of Gene Expression in Auxin and Root Development
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We used whole seedlings for analysis of auxin biosynthesis-related gene expression and roots for analysis of the LR-related and ROS-related gene expression. Tissues were collected for total RNA isolation using TRIzol reagent (TaKaRa) according to the manufacturer’s instructions. Reverse transcription was then performed using PrimeScriptTM RT Reagent Kit with gDNA Eraser (TaKaRa). A quantitative PCR assay was performed using a LightCycler 480II (Roche) apparatus with UItraSYBR Mixture (CWBIO). The PCR assay was performed in 96-well plates as follows: incubation at 95 °C for 10 min for complete denaturation and 45 cycles at 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 20 s. ACTIN2 (AT3G18780) and EF1a (AT5G60390) were used as internal controls for quantitative reverse-transcription polymerase chain reaction (qRT-PCR) normalization with GeNorm (Czechowski et al., 2005 (link)). The qRT-PCR analysis of each gene was performed on three biological replicates, including duplicates for each. The relative transcript levels for each sample were determined and averaged over the six replicates. The specific primers for each gene are listed in supplemental Supplementary Table S1 at JXB online.
5
Quantifying Gene Expression in Brain Tissue and Cultured Astrocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol reagent (Sigma) from a peri-infarct region of brains and cultured astrocytes, and reverse transcribed into cDNA with RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific). A 25-μL reaction system consisted of diluent cDNA (1:10), specific primers and UItraSYBR Mixture (CWBio, China). Amplification was carried out on a Stratagene Mx3000P QPCR system (Agilent Technologies, USA). GAPDH served as an endogenous control. The primer pairs used in this study were: 24p3R-forward 5′-TACCTGATGCGCCTGGAGCT-3′ and 24p3R-reverse 5′-TTCTCCAGTTCCTGCAAAGCTT-3′; GAPDH-forward 5′-AAGAAGGTGGTGAAGCAGG-3′ and GAPDH-reverse 5′-GAAGGTGGAAGAGTGGGAGT-3′.
6
Enzymatic Synthesis and Characterization of Modified Nucleotides
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides with a length > 100 bp were purchased from GenScript, and other Oligonucleotides were purchased from Sangon Biotech (see sequences used in this study). dNTPs were purchased from Solarbio. Klenow fragment DNA polymerase I was purchased from ABclonal Biotech Co., Ltd. OneTaq DNA polymerase, Deep vent DNA polymerase, glycosylase (UDG), apurinic/apyrimidinic Endonuclease 1 (APE1), as well as T4-DNA ligase, were purchased from New England Biolabs. 2 × UItraSYBR Mixture was purchased from CWBIO Biotech co., Ltd. pBLUE-T Fast Cloning Kits and BL 21 (DE3) Electrocompetent cells were purchased from Zoman Biotechnology Co., Ltd. dNaMTP, dTPT3TP, and dTPT3PA were synthesized as reported (8 (link),24 (link)). NMR spectra were performed on AVANCE NanoBay (400 MHz). HRMS or MS were performed on Bruker compact Ultra-high-resolution electro-spray time-of-flight mass spectrometry and Bruker Autoflex speed MALDLTOF/TOF spectrometry, respectively.
7
Quantifying Antibiotic Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qPCR was applied to quantify ARGs and 16S rRNA gene in DNA extracted from samples. The qPCR reactions were conducted in 96-well plates. All real-time qPCR assays were performed in triplicate using the 2× UItraSYBR Mixture (CWBIO, China) on the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, USA). The real-time qPCR program was as follow: initial denaturing at 95°C for 10min, followed by 40 cycles of 10 s at 95°C, 30 s at different annealing temperatures, and 30 s at 72°C. The fluorescence data were acquired at 72°C, and the final melting curve was constructed with temperature ramping up from 65 to 95°C. Tenfold serial diluted calibration curve of each ARG was tested in triplicate on the same PCR plate. For all standard curves, the linear coefficients (R2) were greater than 0.990, and their amplification efficiencies were between 95% and 105%. The equations of standard curves were listed in S3 Table .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!