CAR expression was detected at 4 and 10 days post-transduction with a fluorescein isothiocyanate (FITC)-tagged anti-streptavidin antibody (GenScript, Piscataway, NJ, USA) according to the manufacturer’s protocols. Briefly, 100,000–200,000 cells per transduction were pelleted at 300 × g at room temperature for 10 min in a V-bottom plate. Cells were washed once in PBS before incubation for 30 min at 37°C in blocking buffer (3% bovine serum albumin in PBS). Cells were spun down and resuspended in 100 μL of blocking buffer with 1.5 μg/mL antibody and incubated for 1 h in at 37°C. Cells were pelleted and washed once in wash buffer (0.05% Tween 20 in PBS), fixed in 1% paraformaldehyde, and immediately read by flow cytometry.
Recombinant il 2
Recombinant IL-2 is a laboratory product used for research purposes. It is a protein that can be used to study cellular processes and immune system function. The core function of Recombinant IL-2 is to stimulate the growth and activity of certain types of immune cells.
Lab products found in correlation
13 protocols using recombinant il 2
CAR T-cell Activation and Characterization
CAR expression was detected at 4 and 10 days post-transduction with a fluorescein isothiocyanate (FITC)-tagged anti-streptavidin antibody (GenScript, Piscataway, NJ, USA) according to the manufacturer’s protocols. Briefly, 100,000–200,000 cells per transduction were pelleted at 300 × g at room temperature for 10 min in a V-bottom plate. Cells were washed once in PBS before incubation for 30 min at 37°C in blocking buffer (3% bovine serum albumin in PBS). Cells were spun down and resuspended in 100 μL of blocking buffer with 1.5 μg/mL antibody and incubated for 1 h in at 37°C. Cells were pelleted and washed once in wash buffer (0.05% Tween 20 in PBS), fixed in 1% paraformaldehyde, and immediately read by flow cytometry.
MHC-I Epitope Prediction and T-cell Activation
HIV-1 Infection of Activated Primary CD4+ T-cells
The N153F mutation in Gag was created using the Lightning Site-Directed Mutagenesis Kit (Agilent Tech) according to the manufacturer’s protocol. The primers used were:
5’- GGTACATCAGGCCATATCACCTAGAACTTTATTTGCATGGGTAAAAGTA-3’ and 5’-TAC TTTTAC CCATGCAAATAAAGTTCTAGGTGATATGGCCTGAT-GTACC-3’. Because the mutation will not lead to viable capsid proteins in the virus, we provided a capsid for the virus particle in trans using the ΔR8.2 packaging vector as previously described [52 (link)].
Infection was performed by spin-inoculation with a TCID50 = 1 as described by O’Doherty et al [53 (link)]. Following infection, cells were cultured in RPMI complete medium with 200 U/mL recombinant IL-2 (AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, deposited by Dr. Maurice Gately, Hoffmann-La Roche Inc, Nutley, NJ).
Culturing and Activating Cell Lines
L. jensenii, L. crispatus and C. albicans strain SC5413 (ATCC) were propagated as previously described [23] .
HSV-2 and SHIV Infection of Vaginal Tissues
Activation and Expansion of Human NK Cells
PBMC Activation Assay Protocol
Polyclonal Activation of T Cells
Culturing and Activating Primary CD4+ T Cells
IL-27 Pretreatment Enhances Anti-HIV Activity
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!