Topscripttm rt drymix

Total cellular RNA was extracted using TRIzol reagent (Invitrogen). The cDNAs were synthesized with 5 μg total RNA and TOPscriptTMRT DryMIX (Enzynomics Inc., Dajeon, Korea) according to the manufacturer’s instructions. Amplification was carried out using SYBR Green qPCR Master Mix (Thermo Fisher Scientific). The PCR reactions were performed for 40 cycles of 95 °C for 15 s, 60 °C for 1 min, and 72 °C for 1 min. melting curve analysis was performed. The PCR primer sequences were as follows: human EGR1-F: 5′-ATG ATC CCC GAC TAC CTG TTT-3′, EGR1-R: 5′-CTG AGT GGC AAA GGC CTT AAT-3′ (amplicon length: 144 bp); human GADD45α-F: 5′-GAG AGC AGA AGA CCG AAA G-3′, GADD45α-R: 5′-AGA GCC ACA TCT CTG TCG T-3′ (amplicon length: 186bp); and human GAPDH-F: 5′-GTC TCC TCT GAC TTC AAC AGC G-3′, GAPDH-R: 5′-ACC ACC CTG TTG CTG TAG CCA A-3′ (amplicon length: 131bp). We used 2^−ΔΔCt model for Relative quantification of real-time qPCR fold change. The Ct values provided from real-time PCR instrumentation are imported into Microsoft Excel. Here are the formulae for 2^−ΔΔCt method. ΔCt_ctrl = (Ct_ctrl − Ct _GAPDH), ΔCt_NTPAM = (Ct_NTPAM − Ct_GAPDH). ΔΔCt_ctrl = ΔCt_ctrl − ΔCt_ctrl average, ΔΔCt_NTPAM = ΔCt_NTPAM − ΔCt_{ctrl average}. 2^{−ΔΔCtctrl}, 2^{−ΔΔCtNTPAM} is relative value. Fold change = > 2^{−ΔΔCtctrl}/2^{−ΔΔCtctrl}, 2^{−ΔΔCtNTPAM}/2^{−ΔΔCtctrl} [58 (link)].

Total RNA was extracted from cells using easy-BLUE Total RNA extraction kit (Intron Biotechnology). RNA (500 ng) was reverse transcribed to cDNA using TOPscriptTM RT Dry MIX (Enzynomics, Daejeon, Korea). Human PCR primers against ICAM-1, VCAM-1, and GAPDH were as follows: ICAM-1, Sense-5′-ATGCCCAGACATCTGTGTCC-3′, Antisense-5′-GGGGTCTCTATGCCCAACAA-3′; VCAM-1, Sense-5′- GGGAAGATGGTCGTGATCCTT-3′, Antisense-5′- TCTGGGGTGGTCTCGATTTTA-3′; GAPDH, Sense-5′- CTGGGCTACACTGAGCACC -3′, Antisense-5′- AAGTGGTCGTTGAGGGCAATG -3′. Real-time PCR was performed in triplicate using a SYBR Green Master mix (Toyobo, Japan) using Light cycler 1.5 (TAKARA, Seoul, Korea). The expression levels of the target genes were calculated versus GAPDH.

Total RNA was extracted from HDFs using a GeneAll Ribospin^TM total RNA purification kit (GeneAll Biotechnology Co. Ltd., Seoul, Korea) according to the manufacturer’s instructions. Purified total RNA was reverse-transcribed to cDNA using TOPscript^TM RT DryMIX (Enzynomics Co. Ltd., Daejeon, Korea) with a dT 18 plus primer. Subsequently, a PCR step was performed from the cDNA samples using specific primers and TOPreal^TM qPCR 2X PreMIX (SYBR Green with high ROX, Enzynomics Co. Ltd. Daejeon, Korea) in triplicate on the Eco Real-Time PCR System (Illumina, San Diego, CA, USA). The primers used in this study are summarized in Table 1. The standard cycle conditions were as follows: 95 °C for 1 min, 40 cycles of denaturation at 95 °C for 15 s, and annealing-extension at 60 °C for 30 s. The expression level of specific RNAs was normalized by actin as an endogenous control.

Total cellular RNA was extracted by using Easy Blue^® kits (Intron Biotechnology, Seoul, Korea). RNA (1 μg) was reverse-transcribed (RT) using 0.5 mg/mL random oligonucleotide primers (Promega, Madison, WI, USA) and TOPscript^TM RT DryMIX (Enzynomics, Daejeon, Korea). PCR amplification was performed using the incorporation of SYBR green using SYBR Primix Ex Taq (TaKaRa Bio Inc., Shiga, Japan). The PCR primers used in this study are described in Table S1. Steady-state mRNA levels were determined by real time qPCR using the TaKaRa thermal cycler device. Mean Ct values of genes were calculated from triplicate measurements and normalized versus the mean Ct of GAPDH. The PCR primers used in this study are described in Table S1.

Total RNAs were extracted from cells using Easy Blue kits (Intron Biotechnology). RNAs were converted to cDNAs using TOPscriptTM RT Dry MIX (Enzynomics, Daejeon, Korea). Real-time PCR reactions were run in duplicate for each sample, and transcript levels of each gene were normalized versus GAPDH. The primer sequences used were as follows: ARG-1 sense-5′- AGA GAC CAC GGG GAC CTG GC -3′ and antisense-5′- TGG ACC TCT GCC ACC ACA CC-3′, MRC-1 sense-5′- CTC TGT TCA GCT ATT GGA CGC-3′ and antisense-5′- CGG AAT TTC TGG GAT TCA GCT TC-3′, IL-10 sense-5′- GCT GGA CAA CAT ACT GCT AAC C-3′ and antisense-5′- ATT TCC GAT AAG GCT TGG CAA-3′, UCP-1 sense-5′- ACT GCC ACA CCT CCA GTC AT-3′ and antisense-5′- CTT TGC CTC ACT CAG GAT TG-3′, Cited1 sense-5′- CGC TTC GTC CGT ACC TCA GC-3′ and antisense-5′- CAG CTG GGC CTG TTG GTC TC-3′, COX7a1 sense-5′- AAA GTG CTG CAC GTC CTT G-3′ and antisense-5′- TTC TCT GCC ACA CGG TTT TC-3′, TMEM26 sense-5′- TCC TGT TGC ATT CCC TGG TC-3′ and antisense-5′- GCC GGA GAA AGC CAT TTG T-3′, and GAPDH sense-5′- AGG TCG GTG TGA ACG GAT TTG-3′ and antisense-5′-GGG GTC GTT GAT GGC AAC A-3′, PPARγ sense-5′-CAT CCA AGA CAA CCT GCT GC-3′ and antisense-5′-TGT GAC GAT CTG CCT GAG GT-3′, and PPARδ sense-5′-GCT GCT GCA GAA GAT GGC A-3′ and antisense-5′-CAC TGC ATC ATG TGG GCA TG-3′.

Total cellular RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA) and cDNA was synthesized with 2 µg total RNA and TOPscriptTMRT DryMIX (Enzynomics Inc., Daejeon, Korea) according to the manufacturer’s instructions. Amplification was carried out using SYBR Green qPCR master mix (Thermo Fisher Scientific, Waltham, MA, USA). The PCR reactions were performed for 40 cycles at 95 °C for 15 s, 60 °C for 1 min and 72 °C for 1 min. The primer sequences were as follows: GDF15-F: 5′-TCA GAT GCT CCT GGT GTT GC-3′/GDF15-R: GAT CCC GAA AGC CGC ACT TCT G-3′; GAPDH-F: 5′-ACC CAG AAG ACT GTG GAT GG-3′/GAPDH-R: 5′-TTC TAG ACG GCA GGT CAG GT-3′. The Ct values provided from real-time PCR instrumentation were imported into Microsoft Excel. We used the 2^−∆∆Ct model for relative quantification of real-time qPCR fold changes [47 (link)].

The RAW 264.7 macrophage cells were seeded in a culture dish at a density of 5 × 10⁵/mL. After incubation for 6 h, cells were pretreated with 12.5, 25, and 50 μM of TCMB (11) for 1 h and then stimulated with LPS 100 ng/mL for 6, 12, and 24 h. The cultured media were removed and cells were washed with PBS. Total mRNA was extracted by using Easy Blue^® kits (Intron Biotechnology, Seoul, Republic of Korea) and synthesized to cDNA using 0.5 mg/mL random oligonucleotide primers (Promega, Madison, WI, USA) and TOPscriptTM RTDryMIX (Enzynomics, Daejeon, Republic of Korea). PCR amplification was analyzed by using the incorporation of SYBR green (TaKaRa, Shiga, Japan) and primers for iNOS (forward strand 5′-AAC ATC CTG GAG GAA GTG GG-3′; reverse strand 5′-GCT GTG TGG TGG TCC ATG AT-3′), COX-2 (forward strand 5′-TGC TGT ACA AGC AGT GGC AA-3′; reverse strand 5′-GCA GCC ATT TCC TTC TCT CC-3′), TNF-α (forward strand 5′-AGC ACA GAA AGC ATG ATC CG-3′; reverse strand 5′-CTG ATG AGA GGG AGG CCA TT-3′), IL-1β (forward strand 5′-ACC TGC TGG TGT GTG ACG TT-3′; reverse strand 5′-TCG TTG CTT GGT TCT CCT TG-3′), and IL-6 (forward strand 5′-GGG ACT GAT GCT GGT GAC AA-3′; reverse strand 5′-CCA CGA TTT CCC AGA GAA CA-3′). All primers were purchased from Bioneer (Seoul, Republic of Korea).