Quantstudio real time pcr instrument

Total RNAs were extracted from heart tissues or cells using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. 400 ng RNAs were reversely transcribed with PrimeScript RT reagent kit (Takara, Tokyo, Japan) to obtain cDNAs. QuantStudio Real-Time PCR Instrument (Thermo Fisher) with Bio-Rad SYBR qPCR (Bio-Rad, Hercules, CA, USA) was used to detect mRNA expression. The primers are listed in Supplementary Table 1. 18S was used as an endogenous control. Bulge-Loop™ miRNA qPCR Primer Set (RiboBio) was used to determine miRNA expression levels. 5S was used for miRNA template normalization.

To quantify the mRNA of targets of interest, RNA was extracted from ≈0.5 × 0.5 cm sections of distal colon using a RNeasy^® Mini Kit (Qiagen Inc.) with a DNase step added to eliminate residual genomic DNA. RNA quantity and quality was determined using a Bioanalyzer 2100 (Agilent Technologies Canada Inc.). RNA (1000 ng) was transcribed into cDNA using a QuantiTect^® Reverse Transcription Kit (Qiagen Inc.). Expression of mRNA for interferon-gamma (Ifng), interleukin-4 (Il4), interleukin-22 (Il22), the neutrophil attractant cytokine, keratinocyte-derived cytokine (Kc), transforming growth factor-beta (Tgfb), Toll-like receptor-4 (Tlr4), and tumor necrosis factor-alpha (Tnfa) were standardized against hypoxanthine-guanine phosphoribosyltransferase (Hprt), beta-glucuronidase (Gusb) and glyceraldehyde 3-phosphate dehydrogenase (Gapdh), as previously described [45 (link)]; these reference genes were selected due to the low variation among samples. A Quantstudio Real Time PCR instrument (Thermo Fisher Scientific) was used.

Genomic DNA was extracted from colonic digesta, and densities of total E. coli were measured by qPCR. Genomic DNA was extracted from 80–120 mg of thawed digesta samples using the QIAamp^® Fast DNA Stool Mini Kit (Qiagen Inc.) according to the manufacturer’s recommendations. qPCR was completed with the universal bacterial primer set, HDA1/HDA2 (F: ACTCCTACGGGAGGCAGCAGT; R: GTATTACCGCGGCTGCTGGCAC) [44 (link)], and was completed in triplicate as follows: 1.0 μL of DNA, 5.0 μL of 2× QuantiTect^® SYBR^® Green Master Mix (Qiagen Inc.), 0.9 μL of forward primer, 0.6 μL of reverse primer (10 μM; Integrated DNA Technologies), and 2.5 μL of nuclease-free water (Qiagen Inc.). The qPCR conditions were as follows: one activation cycle at 95 °C for 15 min; 40 cycles at 94 °C for 15 s, 56 °C for 30 s, and 72 °C for 30 s; a final cycle at 95 °C for 1 min; 55 °C for 1 min; and melt-curve analysis. A Quantstudio Real Time PCR instrument (Thermo Fisher Scientific) was used.

Total RNA was extracted from indicated tissues and cells using the RNA isolater Total RNA Extraction Reagent (cat. no. R401, Vazyme, Nanjing, China). Reverse transcription (RT) was performed using the RNA and the HiScript III RT SuperMix for qPCR (cat. no. R323, Vazyme). qPCR was performed using the ChamQ Universal SYBR qPCR Master Mix (cat. no. Q711, Vazyme) on the QuantStudio Real-Time PCR Instrument (Applied biosystems, Foster City, CA, USA). The sequences of primers for qPCR were as follows: 5'-ATTTATCTCTTCCCCCAAAAG-3' (sense) and 5'-GCGGAGTGTGGACACATCT-3' (antisense) for SREBF2-AS1, 5'-CACCTCACTGCCCCATCTT-3' (sense) and 5'-TGAACGCCTTTTCTTGCTAA-3' (antisense) for SREBF2-AS1 (another primer pair), 5'-GCTGTAGTGAGATCCTGGT-3' (sense) and 5'-GAAACTTTGGGCAGCGACT-3' (antisense) for mutated SREBF2-AS1, 5'-GGCAAATCAAAAGAACAAGC-3' (sense) and 5'-AGAGTCAATGGAGTAGGGAGA-3' (antisense) for SREBF2, 5'-ATTTCTCCTATACTGTGGG-3' (sense) and 5'-ACTCTGGTTTGGGTTGTC-3' (antisense) for STARD4, 5'-GTCGGAGTCAACGGATTTG-3' (sense) and 5'-TGGGTGGAATCATATTGGAA-3' (antisense) for GAPDH. GAPDH served as the internal control. Relative expression was analyzed using the 2^−ΔΔCt method.

Total RNA was isolated from the hypothalamus using TRIzol^® (Invitrogen, Brazil) according to the manufacturer’s instructions. The quantification of total RNA was done by spectrometry BioSpec-nano^® (Shimazu, Kioto, Japan) at 260 and 280 nm. For cDNA synthesis, 1,000 ng of RNA were reverse transcribed according to the manufacturer’s instructions (GoScript Reverse Transcription Kit, Promega, Brazil). To conduct real time quantitative polymerase chain reaction (RT-qPCR), cDNA was added to a reaction mix (10 μL final volume) containing 100 nM gene-specific primers and universal SYBR green supermix (Applied Biosystems, Thermo Fisher Scientific CA, USA). All samples were run in duplicate and were analyzed on an QuantStudio Real-Time PCR instrument (Applied Biosystems, Thermo Fisher Scientific CA, USA) for quantitative monitoring of PCR product formation. Relative gene expression was normalized to β-Actin controls and assessed using the 2-ΔΔCT method. Primer sequences are as follows: β-Actin: F: TATGCCAACACAGTGCTGTCTGG; β-Actin: R: TACTCCTGCTTGCTGATCCACAT; Iba1: F: GCAAG GATTTGCAGGGAGGA; Iba1: R: CGTCTTGAAGGCCTCCAG TT; GFAP: F: CGAAGAAAACCGCATCACCA; GFAP: R: CC GCATCTCCACCGTCTTTA; TNFα: F: TGGCGTGTTCATCCG TTCTCTACC; TNFα: R: CCCGCAATCCAGGCCACTACTT; IL6: F: GACCAAGACCATCCAACTCATC; IL6: R: GCTTAG GCATAGCACACTAGG; IL1β: F: TGAGGCTGACAGACCCCAA AAGAT; IL1β: R: GCTCCACGGGCAAGACATAGGTAG.